1
Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pBAD-DEST 49 Gateway

Source/Vendor: Invitrogen
Plasmid Type: Bacterial Expression
Promotor: araBAD
Expression Level: Tightly controlled
Clone Method: Unknown
5' Sequencing 1 Primer: pBad Fwd
5' Sequencing 1 Primer Sequence: 5'd[ATGCCATAGCATTTTTATCC]3'
Tag 1: 6X His, V5
Bacterial Resistance: Ampicillin
Notes:
Okay to use with Top10 OneShot comp cells
Stable: Transient
Constitutive: Constitutive
Viral/Non-Viral: Nonviral