Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pcDNA-DEST47

Source/Vendor: Invitrogen
Alt Name: pDEST47
Analyze: Sequence
Plasmid Type: Mammalian Expression
Promotor: CMV
Expression Level: High
Clone Method: Unknown
Size: 7780
5' Sequencing 1 Primer: T7 Fwd
5' Sequencing 1 Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'
Tag 1: GFP (Cterm)
Bacterial Resistance: Ampicillin
Selectable Marker: Neomycin
Easy to clone into other vectors
Catalog Number: 12281-010
Stable: Transient
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map