1

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.


Plasmid: pEF5/FRT/V5 D-TOPO

Source/Vendor: Invitrogen
Analyze: Sequence
Plasmid Type: Mammalian Expression
Promotor: EF-1a
Clone Method: Unknown
Size: 5831
5' Sequencing 1 Primer: T7 Fwd
5' Sequencing 1 Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'
Tag 1: V5
Bacterial Resistance: Ampicillin
Selectable Marker: Hygromycin
Catalog Number: K6035-01
Stable: Stable
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map