Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more


Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pEGFP-N3

This vector is NOT available from Addgene.

This page is informational only.

Please contact the manufacturer for further details.

Source/Vendor: Clontech
Analyze: Sequence
Plasmid Type: Mammalian Expression
Promotor: CMV
Cloning Method: Unknown
Size: 4700
5' Sequencing 1 Primer: EGFP-N
5' Sequencing 1 Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'
Tag 1: EGFP (Cterm)
Bacterial Resistance: Kanamycin
Selectable Marker: Neomycin
Notes:
This plasmid has been discontinued by Clontech. For alternative plasmids with fluorescent tags, try plasmids from Doug Golenbock's Lab (http://www.addgene.org/browse/article/979/) or plasmids from Vladislav Verkhusha's Lab (http://www.addgene.org/browse/pi/1030/articles/).
Catalog Number: 6080-1
Stable: Stable
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map

Loading...