1

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.


Plasmid: pEXP2-DEST (Expressway in vitro)

Source/Vendor: Invitrogen
Analyze: Sequence
Plasmid Type: Other, In vitro
Clone Method: Unknown
Size: 4400
5' Sequencing 1 Primer: T7 Fwd
5' Sequencing 1 Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'
Tag 1: 6X His, Xpress (Cterm)
Bacterial Resistance: Other
Selectable Marker: Zeocin
Catalog Number: V96002
Stable: Unspecified
Constitutive: Unspecified
Viral/Non-Viral: Unspecified

Generated Plasmid Map