1

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.


Plasmid: pVITRO2-hygro-mcs

Source/Vendor: InvivoGen
Analyze: Sequence
Plasmid Type: Mammalian Expression, bicistronic
Promotor: hFerH and hFerL composite promoters
Expression Level: High
Clone Method: Unknown
Size: 6321
5' Sequencing 1 Primer: EF-1a-F
5' Sequencing 1 Primer Sequence: TCAAGCCTCAGACAGTGGTTC
Bacterial Resistance: Hygromycin
Selectable Marker: Hygromycin
Stable: Unspecified
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map