Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Adeno FT
(Plasmid #101824)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101824 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pacAd5
  • Backbone manufacturer
    Gene Transfer Vector Core University of Iowa
  • Backbone size w/o insert (bp) 5679
  • Total vector size (bp) 11538
  • Vector type
    Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    U6_sgRNA(Fgfr3)_U6_sgRNA(Tacc3)_CBh_FLAG-Cas9
  • Alt name
    pacAd5_FT
  • gRNA/shRNA sequence
    Fgfr3 (intron 17) Tacc3 (intron 6)
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_001163215.2 NM_001040435
  • Entrez Gene
    Fgfr3 (a.k.a. CD333, FR3, Fgfr-, Fgfr-3, Flg-2, HBGF, HBGFR, Mfr3, sa, sam3)
  • Entrez Gene
    Tacc3 (a.k.a. A, Aint, C86661, Eric1)
  • Promoter U6 and CBh
  • Tag / Fusion Protein
    • FLAG-Cas9

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer GATGTTGTAGTAAATTTGGG
  • 3′ sequencing primer ATCATGTCTGGATCTCCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Adeno FT was a gift from Andrea Ventura (Addgene plasmid # 101824 ; http://n2t.net/addgene:101824 ; RRID:Addgene_101824)
  • For your References section:

    Somatic chromosomal engineering identifies BCAN-NTRK1 as a potent glioma driver and therapeutic target. Cook PJ, Thomas R, Kannan R, de Leon ES, Drilon A, Rosenblum MK, Scaltriti M, Benezra R, Ventura A. Nat Commun. 2017 Jul 11;8:15987. doi: 10.1038/ncomms15987. 10.1038/ncomms15987 PubMed 28695888