-
PurposeExpresses SLC39A14/ZIP14 wild-type in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104380 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N3
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6200
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSLC39A14
-
Alt nameZIP14
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1500
-
Entrez GeneSLC39A14 (a.k.a. HMNDYT2, LZT-Hs4, NET34, ZIP14, cig19)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GTC GGT ACC ATG AAG CTG CTG CTG CTG CAC
- 3′ sequencing primer CGCGGATCCCCCAATCTGGATCTGTCCTGAATA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SLC39A14-GFP was a gift from Somshuvra Mukhopadhyay (Addgene plasmid # 104380 ; http://n2t.net/addgene:104380 ; RRID:Addgene_104380) -
For your References section:
Hypothyroidism induced by loss of the manganese efflux transporter SLC30A10 may be explained by reduced thyroxine production. Liu C, Hutchens S, Jursa T, Shawlot W, Polishchuk EV, Polishchuk RS, Dray BK, Gore AC, Aschner M, Smith DR, Mukhopadhyay S. J Biol Chem. 2017 Oct 6;292(40):16605-16615. doi: 10.1074/jbc.M117.804989. Epub 2017 Aug 31. 10.1074/jbc.M117.804989 PubMed 28860195