bSLS.114
(Bacterial strain
#191530)
-
PurposeContains a knockout gene in the E. coli strain BL21-AI
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 191530 | Bacteria in agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonen/a
-
Vector typeThis is a strain, not a plasmid
Growth in Bacteria
-
Bacterial Resistance(s)None
-
Growth Temperature37°C
-
Growth Strain(s)bSLS.114
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameE. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
-
SpeciesE.coli
Cloning Information
- Cloning method Unknown
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derived from BL21(AI), grow in LB in BSL1 laboratory conditions
Genotype: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
Genotyping primers: CATGTGCATGAAAACCACTGC / CTGGTTGGACGAAGAAGTGC (273 base amplicon)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
bSLS.114 was a gift from Seth Shipman (Addgene plasmid # 191530) -
For your References section:
Precise genome editing across kingdoms of life using retron-derived DNA. Lopez SC, Crawford KD, Lear SK, Bhattarai-Kline S, Shipman SL. Nat Chem Biol. 2022 Feb;18(2):199-206. doi: 10.1038/s41589-021-00927-y. Epub 2021 Dec 23. 10.1038/s41589-021-00927-y PubMed 34949838