-
Purpose(Empty Backbone) pMAD2 derivative designed for chromosomal gene ectopic complementation in Staphylococcus aureus
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMAD2
-
Modifications to backbonepECTO a Gram negative/Gram positive shuttle vector derived from pMAD2 designed to integrate DNA sequences between SAOUHSC_00278 and SAOUHSC_00279 (NCTC8325 nomenclature HG003). It carries about 1kb of both sequences. A terminator introduced between the SAOUHSC_00278 and SAOUHSC_00279 sequences prevents polar effects associated with the expression of inserted genes.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThis a Gram negative/Gram positive shuttle vector with two specialized replicons and antibiotic markers. pBR322 replicon and ampicillin resistance for E. coli. pE194(ts) replicon and erythromycin resistance for S. aureus. In S. aureus, the plasmid propagates at T<30°C, it becomes a suicide vector at T>37°C.
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCCAATATAATCATTTATCAACTCT
- 3′ sequencing primer TCTACCTGCCTGGACAGCAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pECTO can be used for ectopic complementation or any chromosomal gene insertions in S. aureus. It allows insertions between SAOUHSC_00278 and SAOUHSC_00279, a conserved region with no detected transcription. DNA sequences are inserted in pECTO using the unique ClaI and SalI restriction sites or more practically by Gibson assembly method. pECTO derives from pMAD2.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pECTO was a gift from Philippe Bouloc (Addgene plasmid # 67683 ; http://n2t.net/addgene:67683 ; RRID:Addgene_67683)