pMSM14 [sng-1p::sng-1::eGFP::SspBmilli::ScBoNT/B(147-441, Y365A)::SL2::mCh::ScBoNT/B(1-146)::iLID(V416I)]
(Plasmid #124067)

• Purpose: Expresses both parts of vesicular PaBoNT separately (SL2 trans-splicing site) under the control of the pan-neuronal C. elegans promoter sng-1p.
• Depositing Lab: Alexander Gottschalk
• Publication: Liu et al Neuron. 2019 Jan 15. pii: S0896-6273(19)30003-0. doi: 10.1016/j.neuron.2019.01.002.

Backbone

• Vector backbone: pPD95_75
• Backbone manufacturer: Andrew Fire
• Backbone size w/o insert (bp): 3498
• Total vector size (bp): 11276
• Vector type: Bacterial Expression, Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Vesicular Photoactivatable Botulinum Neurotoxin
• Alt name: vPaBoNT_worm
• Species: C. elegans (nematode)
• Insert Size (bp): 6138
• Mutation: BoNT (Y365A); SspB_milli (A57V and R73Q); iLID (V416I); S. cerevisiae codon-optimized
• GenBank ID: CP013243.1
• Promoter: sng-1p

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CATTTCATTCCAGCTCATTCCA
• 3′ sequencing primer: CAGGGAGAAAGAGCATGTAG

Resource Information

• Supplemental Documents:
  • pmsm14-psng-1sng-1egfpsspbmilliscbontbcsl2mcherryscbontbnilid.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry