EGFP-Rab6AN126I
(Plasmid
#49486)
-
Purposeexpresses EGFP-Rab6AN126I (no nucleotide mutant) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEGFP C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5320
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab6AN126I
-
Alt nameRab6A isoform b
-
SpeciesH. sapiens (human)
-
Insert Size (bp)627
-
MutationAsparagine 126 to Isoleucine
-
GenBank ID
-
Entrez GeneRAB6A (a.k.a. RAB6)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI/BglII (destroyed during cloning)
- 3′ cloning site XhoI/SalI (destroyed during cloning)
- 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypurchased pCDNA3.1+Rab6A from Missouri S&T cDNA Resource Center (cDNA.org). Quick Change mutagenesis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-Rab6AN126I was a gift from Marci Scidmore (Addgene plasmid # 49486) -
For your References section:
The Rab6 effector Bicaudal D1 associates with Chlamydia trachomatis inclusions in a biovar-specific manner. Moorhead AR, Rzomp KA, Scidmore MA. Infect Immun. 2007 Feb;75(2):781-91. Epub 2006 Nov 13. 10.1128/IAI.01447-06 PubMed 17101644