GST-Rab4A
(Plasmid #49566)

• Purpose: expresses GST-Rab4A in E. coli
• Depositing Lab: Marci Scidmore
• Publication: Cortes et al Infect Immun. 2007 Dec;75(12):5586-96. Epub 2007 Oct 1.

Backbone

• Vector backbone: pGEX-4T-1
• Backbone manufacturer: Amersham
• Backbone size w/o insert (bp): 4900
• Total vector size (bp): 5400
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rab4A
• Species: H. sapiens (human)
• Insert Size (bp): 600
• GenBank ID: AF498934
• Entrez Gene: RAB4A (a.k.a. HRES-1, HRES-1/RAB4, HRES1, RAB4)
• Promoter: tac inducible with IPTG
• Tag / Fusion Protein:
  • GST (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: pGEX Fwd (GGGCTGGCAAGCCACGTTTGGTG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Rab4A generated from pCDNA3.1+Rab4A purchased from Missouri S&T cDNA Resource Center

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry