Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GBK-Rab30Q68LdeltaCCNFN
(Plasmid #49849)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49849 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    GBK-T7
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7300
  • Total vector size (bp) 7900
  • Vector type
    Yeast Expression
  • Selectable markers
    Neomycin (select with G418), TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab30
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    600
  • Mutation
    glutamine 68 to leucine, deleted cysteine 199, cysteine 200, asparagine 201, phenylalanine 202, asparagine 203
  • GenBank ID
    AF498956
  • Entrez Gene
    RAB30
  • Promoter ADHI
  • Tags / Fusion Proteins
    • Gal4 Binding Domain (N terminal on insert)
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer T7 (TAATACGACTCACTATAGGG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Rab30 derived from pCDNA3.1+HA-Rab30 purchased from Missouri S&T cDNA Resource Center

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GBK-Rab30Q68LdeltaCCNFN was a gift from Marci Scidmore (Addgene plasmid # 49849)