GBK-Rab30Q68LdeltaCCNFN
(Plasmid
#49849)
-
Purposeexpresses GAL4BD-Rab30Q68LdeltaCCNFN in yeast
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49849 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneGBK-T7
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7300
- Total vector size (bp) 7900
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418), TRP1
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab30
-
SpeciesH. sapiens (human)
-
Insert Size (bp)600
-
Mutationglutamine 68 to leucine, deleted cysteine 199, cysteine 200, asparagine 201, phenylalanine 202, asparagine 203
-
GenBank IDAF498956
-
Entrez GeneRAB30
- Promoter ADHI
-
Tags
/ Fusion Proteins
- Gal4 Binding Domain (N terminal on insert)
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer T7 (TAATACGACTCACTATAGGG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRab30 derived from pCDNA3.1+HA-Rab30 purchased from Missouri S&T cDNA Resource Center
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GBK-Rab30Q68LdeltaCCNFN was a gift from Marci Scidmore (Addgene plasmid # 49849)