pFB-U6_CreOff-CMV-tdTomato-WRE-bGHpA
(Plasmid
#58668)
-
Purpose(Empty Backbone) Expresses Cre regulated (Cre off) shRNA of interest and fluorescent reporter tdtomato
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58668 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneunknown
- Backbone size (bp) 8104
-
Vector typeMammalian Expression, RNAi, Cre/Lox
- Promoter U6
-
Selectable markersGentamicin
-
Tag
/ Fusion Protein
- CMV-tdTomato (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pLLU-5 cacagacttgtgggagaagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Can insert shRNA in XhoI/BamHI sites for expression from U6 promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-U6_CreOff-CMV-tdTomato-WRE-bGHpA was a gift from Savio Chan (Addgene plasmid # 58668)