Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLL3.7-EF1-TNFa-DsRed
(Plasmid #72559)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72559 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLL3.7
  • Backbone size w/o insert (bp) 8424
  • Total vector size (bp) 9142
  • Modifications to backbone
    U6 promoter to GFP was replaced with EF-1-IRES-DsRed
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse TNFalpha cDNA
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    718
  • GenBank ID
    NM_013693
  • Entrez Gene
    Tnf (a.k.a. DIF, TNF-a, TNF-alpha, TNFSF2, TNFalpha, Tnfa, Tnfsf1a, Tnlg1f)
  • Promoter EF-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCACTTGATGTAATTCTCC
  • 3′ sequencing primer CCACAACTATCCAACTCACAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL3.7-EF1-TNFa-DsRed was a gift from Kazuhiro Oka (Addgene plasmid # 72559)
  • For your References section:

    Gene therapy for neuropathic pain by silencing of TNF-alpha expression with lentiviral vectors targeting the dorsal root ganglion in mice. Ogawa N, Kawai H, Terashima T, Kojima H, Oka K, Chan L, Maegawa H. PLoS One. 2014 Mar 18;9(3):e92073. doi: 10.1371/journal.pone.0092073. eCollection 2014. PONE-D-13-38046 [pii] PubMed 24642694