pLL3.7-EF1-TNFa-DsRed
(Plasmid
#72559)
-
PurposeExpress mouse TNFalpha cDNA under EF1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72559 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLL3.7
- Backbone size w/o insert (bp) 8424
- Total vector size (bp) 9142
-
Modifications to backboneU6 promoter to GFP was replaced with EF-1-IRES-DsRed
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse TNFalpha cDNA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)718
-
GenBank IDNM_013693
-
Entrez GeneTnf (a.k.a. DIF, TNF-a, TNF-alpha, TNFSF2, TNFalpha, Tnfa, Tnfsf1a, Tnlg1f)
- Promoter EF-1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCACTTGATGTAATTCTCC
- 3′ sequencing primer CCACAACTATCCAACTCACAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLL3.7-EF1-TNFa-DsRed was a gift from Kazuhiro Oka (Addgene plasmid # 72559) -
For your References section:
Gene therapy for neuropathic pain by silencing of TNF-alpha expression with lentiviral vectors targeting the dorsal root ganglion in mice. Ogawa N, Kawai H, Terashima T, Kojima H, Oka K, Chan L, Maegawa H. PLoS One. 2014 Mar 18;9(3):e92073. doi: 10.1371/journal.pone.0092073. eCollection 2014. PONE-D-13-38046 [pii] PubMed 24642694