pTX-crimson
(Plasmid
#86702)
-
PurposeCmR, AmpR; pHCMC04 derivative plasmid with crimson gene inserted in EcoRV GAT^ATC site.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86702 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHCMC04
-
Backbone manufacturerNguyen et al., 2005
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecrimson
-
Insert Size (bp)677
- Promoter PxylA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGAAAGGGGGATGTGCTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTX-crimson was a gift from Volker Wendisch (Addgene plasmid # 86702) -
For your References section:
Magnesium aminoclay-based transformation of Paenibacillus riograndensis and Paenibacillus polymyxa and development of tools for gene expression. Brito LF, Irla M, Walter T, Wendisch VF. Appl Microbiol Biotechnol. 2016 Nov 23. 10.1007/s00253-016-7999-1 [pii] PubMed 27878581