Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pJFCAT1
Information
- Source/Vendor
- ATCC
- Plasmid Type
- Unspecified
- Cloning Method
- Unknown
- Size
- 5603
- Notes
- Created by Moore, July 1995, under contract with NCBI. Deposited by: Judith L. Fridovich-Keil A promoter/enhancer-cloning shuttle vector using chloramphenicol acetyltransferase (CAT) as the reporter gene. [1] Promoter elements cloned into the polylinker may be sequenced using the following oligonucleotide primers: primer 1: 5'-TCCTTAGCTCCTGAAAATCT-3'; primer 2: 5'-AAACTCATCAATGTATCTTA- 3'. [1] Contains a trimer cassette of the SV40 major late polyadenylation signal to block background readthrough expression of the reporter gene. [1] The order of the major features in this phagemid is : HindIII - SV40 polyadenylation trimer - primer 2 site - BamHI/MCS/XhoI - primer 1 site - CAT gene - SV40 splice and polyadenylation signal - f1 ori - KpnI - SstI - ampR/pUC18. [1] The KpnI and SstI sites can be used for cloning enhancer elements. [1] Restriction digests of the clone give the following sizes (kb): HindIII--5.0, 0.75; EcoRI/HindIII--2.7, 2.0, 0.75, 0.3; XhoI--5.8. (ATCC staff) To avoid potential problems using primer 2, try the following primer sequence instead (assumes promoter inserted at or downstream of the SphI site): 5' TTATCATGTCTGGATCCAAG 3' (personal communication) Medium is 1227 LB plus ampicillin. Hosts: E.coli, E.coli HB101, vertebrate cells. Related vectors: pBLCAT3, pUC18, SV40. (Information source: VectorDB ( http://seq.yeastgenome.org/vectordb ).)
- Catalog Number
- 77317
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified