Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Full Site Search

Searches all Addgene web content.

Search for Plasmids

Optimized to search plasmid data.

Sort
Filters clear all

Service

clear

Expression

clear

Experimental Use

clear

Plasmid Type

clear

Insert Species

clear

Selectable Marker

clear

Resistance

clear

Popularity

clear

799 Results for:  mKate M41G S158C

Your Selections:

Plasmids, Strains, and Pooled Libraries 1–20 of 799

  1. Plasmid
    #104012
    Depositor
    Purpose
    Plasmid encoding mNeptune2
    Insert
    mNeptune2 Synthetic
    Use
    Low copy
    Tags
    None
    Expression
    Bacterial
    Mutation
    Mutations relative to eqFP578...
  2. mKate-pBAD Empty backbone
    Plasmid
    #54826
    Depositor
    Purpose
    Localization: Protein Expression Vector , Excitation: 588, Emission: 635
    Use
    Tags
    mKate, 6xHis
    Expression
    Bacterial
    Mutation
    None
  3. mKate1.31-pBAD Empty backbone
    Plasmid
    #54827
    Depositor
    Purpose
    Localization: Protein Expression Vector , Excitation: 588, Emission: 635
    Use
    Tags
    mKate1.31, 6xHis
    Expression
    Bacterial
    Mutation
    None
  4. mKate1.31-Lifeact-7 Empty backbone
    Plasmid
    #54668
    Depositor
    Purpose
    Localization: Actin, Excitation: 588, Emission: 635
    Use
    Tags
    LifeAct-mKate1.31
    Expression
    Mammalian
    Mutation
    None
  5. mKate-Lifeact-7 Empty backbone
    Plasmid
    #54697
    Depositor
    Purpose
    Localization: Actin, Excitation: 588, Emission: 635
    Use
    Tags
    LifeAct- mKate
    Expression
    Mammalian
    Mutation
    None
  6. Plasmid
    #105945
    Depositor
    Purpose
    heat shock inducible transgenesis, cytosolic mKate2
    Insert
    mKate2
    Use
    Tags
    None
    Expression
    Bacterial
    Mutation
    None
  7. Plasmid
    #80812
    Depositor
    Purpose
    myc epitope fused to C-terminus of mKate2 without pA
    Insert
    mKateHA p3E
    Use
    Tags
    None
    Expression
    Mammalian
    Mutation
    None
  8. Plasmid
    #62716
    Depositor
    Purpose
    Empty; no U6 gRNA cassette
    Insert
    Cas9–mKate2ps Synthetic
    Use
    Tags
    None
    Expression
    Mammalian
    Mutation
    None
  9. Plasmid
    #62717
    Depositor
    Purpose
    t1 gRNA (ATGAGAATCAAGGCGGTCGA)
    Insert
    Cas9–mKate2ps Synthetic
    Use
    Tags
    None
    Expression
    Mammalian
    Mutation
    None
  10. Plasmid
    #112004
    Depositor
    Purpose
    For enriched expression of GCaMP6s in axons with cytosolic expression of mKate2
    Insert
    axon-GCaMP6s-P2A-mKate2 Synthetic
    Use
    AAV
    Tags
    GAP43 palmitoylation domain
    Expression
    Mammalian
    Mutation
    None
  11. Plasmid
    #64955
    Depositor
    Purpose
    Control gRNA (GTCAAGGCACTCTTGCCTA)
    Insert
    Cas9–mKate2ps
    Use
    Tags
    None
    Expression
    Mammalian
    Mutation
    None
  12. Plasmid
    #44943
    Depositor
    Purpose
    Yeast tagging vector to create gene fusion with yeast optimized LSS-mKate2 with Kan selection
    Insert
    yoLSS-mKate2 Synthetic
    Use
    Tags
    None
    Expression
    Yeast
    Mutation
    None
  13. Plasmid
    #122619
    Depositor
    Purpose
    Punc4::QF2::QS::mKate
    Insert
    QF2::QS::mKate Nematode
    Use
    Tags
    None
    Expression
    Worm
    Mutation
    None
  14. Plasmid
    #70685
    Depositor
    Purpose
    mKate2^SEC^3xMyc vector with ccdB sites for cloning homology arms
    Insert
    mKate2-C1^SEC^3xFlag Nematode, Synthetic
    Use
    Cre/Lox, CRISPR
    Tags
    C. elegans codon-optimized mK...
    Expression
    Worm
    Mutation
    None
  15. Plasmid
    #99129
    Depositor
    Purpose
    Also known as pAAV-GFAP-mKate2.5-f. An AAV genome that express the farnesylated fluorescent protein mKate2.5 from the GFAP promoter
    Insert
    mKate2.5f
    Use
    AAV
    Tags
    None
    Expression
    Mammalian
    Mutation
    None
  16. Plasmid
    #44848
    Depositor
    Purpose
    Yeast tagging vector to create gene fusion with yeast optimized LSS-mKate2 with SpHis5 selection
    Insert
    yoLSS-mKate2 Synthetic
    Use
    Tags
    None
    Expression
    Yeast
    Mutation
    None
  17. Plasmid
    #104030
    Depositor
    Purpose
    Plasmid encoding 2ndVal mKate2
    Insert
    2ndVal mKate2 Synthetic
    Use
    Low copy
    Tags
    None
    Expression
    Bacterial
    Mutation
    mKate2 with valine inserted i...
  18. Plasmid
    #44886
    Depositor
    Purpose
    Yeast tagging vector to create gene fusion with yeast optimized LSS-mKate2 with CaUra3 selection
    Insert
    yoLSS-mKate2 Synthetic
    Use
    Tags
    None
    Expression
    Yeast
    Mutation
    None
  19. Plasmid
    #84474
    Depositor
    Purpose
    pAAV-RAM-NLS-mKate2
    Insert
    mKate2
    Use
    AAV
    Tags
    Nuclear localization signal o...
    Expression
    Mutation
    None
  20. Plasmid
    #105186
    Depositor
    Purpose
    Module 3 - GAL4 synthetic promoter (with eight binding sites) drives the expression of mKate2 transcripts containing miR1-Bs(Pe)
    Insert
    G8p-mKate2-1Pe Synthetic
    Use
    Lentiviral, Synthetic Biology
    Tags
    None
    Expression
    Mammalian
    Mutation
    None
First « Previous
Next » Last