We narrowed to 18,776 results for: ERG
-
Plasmid#108738PurposeExpresses aa271 to C-terminus of Cre recombinase fused to FKBP CIDDepositorInsertCre recombinase fragment aa271 to C-terminus
UseCre/Lox and Synthetic BiologyTagsFKBP and NLSExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2610_pCAG-PV1-FKBP-L1-iCre-257C-NLS-BGHpA
Plasmid#108736PurposeExpresses aa257 to C-terminus of Cre recombinase fused to FKBP CIDDepositorInsertCre recombinase fragment aa257 to C-terminus
UseCre/Lox and Synthetic BiologyTagsFKBP and NLSExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
PresentER-NLVPMVATV (GFP)
Plasmid#102947PurposePresentER minigene encoding HLA-A*02:01 ligand NLVPMVATV (GFP)DepositorInsertNLVPMVATV
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHW449
Plasmid#198805PurposeDirect light-gated cation channel from Chlamydomonas reinhardtii that allows neuron deploarization through brief pulses of blue light.DepositorInsert15xUAS::hChR2(H134R)-YFP::let-858 3'UTR
ExpressionWormAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-hRNF216
Plasmid#167354PurposeExpression of human RNF216 (Triad3A) codon optimized for E. coli and insect cellsDepositorInsertE3 ubiquitin-protein ligase RNF216 (RNF216 Human)
Tags3C protease cleavage site and 6x-His tagExpressionBacterialMutationcodon optimised for expression in E. coliPromoterT7Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR_P2R-P3_R2-miniTurbo-NES-mVenus-STOP-L3
Plasmid#127355Purposegateway entry vector for making C-terminal miniTurbo-mVenus fusion with non-nuclear proteinsDepositorInsertminiTurbo (BirA mutant)
UseGateway CloningTagsGS linker, NES, V5, and mVenusMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Promoterno promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUG-natNT2
Plasmid#110922Purposeexpression of nat gene conferring resistance to nourseothricin for gene deletion in yeastDepositorInsertnat
ExpressionBacterial and YeastPromoterAgTEF1Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
EF1a-LCB1_v1.3-PDGFR-T2A-mCherry (pZYW048)
Plasmid#194231PurposeLentiviral expression vector expressing LCB1 on the cell surface attached to PDGFR's transmembrane domain and mCherry transduction markerDepositorInsertEF1a-LCB1-PDGFR TMD-T2A-mCherry
UseLentiviralPromoterEF1aAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
EK0007-PB-4XnrUAS-H2B-BFP
Plasmid#236121PurposeFuorescent reporter encoding H2B-tagBFP fusion under control of E1b minimal promoter with four Gal4-binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsmTagBFP2ExpressionMammalianPromoterE1b minimal promoter with four Gal4-binding sites…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only