We narrowed to 11,125 results for: HA
-
Plasmid#215907PurposeExpression of TNRC6A-silencing domain (SD) with S1332A/S1346A mutationDepositorInsertTNRC6A (TNRC6A Human)
TagsFlag-HA-SBPExpressionMammalianMutationcontain aa1224-1709, S1332A, S1346AAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA.5.1-FHS-TNRC6A-SD-S1616D/S1691D
Plasmid#215908PurposeExpression of TNRC6A-silencing domain (SD) with S1616D/S1691D mutationDepositorInsertTNRC6A (TNRC6A Human)
TagsFlag-HA-SBPExpressionMammalianMutationcontain aa1224-1709, S1616D, S1691DAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_dCas9-XTEN-KRAB-p2A-mCherry
Plasmid#222107PurposeDonor vector for CRISPRi integration at AAVS1 with an mCherry fluorophoreDepositorInsertCRISPRi-kox1(KRAB) (cas9 Human, S. pyogenes)
UseAAV and CRISPRTagsHA and P2A-mCherryExpressionMammalianMutationD10A, H840AAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Stargazin-EBFP2-FRB
Plasmid#222417PurposeTo express a plasma membrane "anchor" for rapamycin-induced heterodimerisation in mammalian cellsDepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-FCPF
Plasmid#220131PurposeExpresses dCas9-FCPF in mammalian cellsDepositorAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_dCas9-XTEN-KRAB-p2A-GFP
Plasmid#222108PurposeDonor vector for CRISPRi integration at AAVS1 with a GFP fluorophoreDepositorInsertCRISPRi-kox1(KRAB) (cas9 Human, S. pyogenes)
UseAAV and CRISPRTagsHA and P2A-GFPExpressionMammalianMutationD10A, H840AAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEM-601[insert(+1) TA-rich]
Plasmid#221196Purpose601 nucleosome positioning sequence with an additional base pair inserted 22 nt from the dyad on the TA-rich side of the 601DepositorInsert601[insert(+1)TA-rich]
UseUnspecifiedMutation601 has an additional mutation added 22 bp from d…Available SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNS49 (enAsCas12a-KRAB piggyBac)
Plasmid#217335PurposepiggyBac expresion of enAsCas12a-KRABDepositorInsertenAsCas12a
UseCRISPRTags6xMycNLS and HA-SV40NLS-XTEN80-KRAB-P2A-TagBFP2ExpressionMammalianMutationE174R/S542R/K548RPromoterCAGAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FKBP12-CB2mutx2-mTagBFP2-HAx2
Plasmid#207147PurposeTandem mutant calcium-buffer with rapalog dimerizerDepositorInsertCalbindin-2 (CALB2 Human)
TagsFKBP12, HA, and mTagBFP2ExpressionMammalianMutationE40Q, E87Q, E131Q, E175Q, E219QPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
185_pETcon_SARS2_BQ1-1
Plasmid#208085Purposeyeast surface display of the SARS-CoV-2 BQ.1.1 variant RBDDepositorAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
186_pETcon_SARS2_XBB1-5
Plasmid#208086Purposeyeast surface display of the SARS-CoV-2 XBB.1.5 variant RBDDepositorInsertSARS-CoV-2 XBB.1.5 RBD (S SARS-CoV-2 virus, Budding Yeast)
TagsHA and c-MycExpressionYeastAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcS-RDG-C1C2
Plasmid#200163PurposeThis plasmid encodes non-binder control monobody (RDG) fused to the extracellular vesicle binding domain (C1C2) of lactadherin for surface engineering extracellular vesicles.DepositorInsertsRDG-C1C2
C1C2 domain of lactadherin
TagsHA and HISExpressionMammalianMutationsequence adopted from doi: 10.1371/journal.pone.0…Available SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CALPAIN-7-mCherry, F98D
Plasmid#180653PurposeLentiviral expression vector for CALPAIN-7. Used for generating cell lines. F98D mutation. Has C-terminal mCherry tag. Dox-inducible. Internal ID: WISP20-53.DepositorInsertCALPAIN-7
UseLentiviralTagsmCherryExpressionMammalianMutationsiRNA resistant to: GCACCCAUACCUUUACAUUAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA528 RPS6KL1 MIT, residues 20-140
Plasmid#180623PurposeBacterial expression for RPS6KL1 MIT domain, residues 20-140. Has N-terminal HIS-SUMO tag. Internal ID: WISP20-32.DepositorInsertRPS6KL1 (RPS6KL1 Human)
TagsHIS-SUMOExpressionBacterialMutationResidues 20-140PromoterT7Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-THTAP-SNX15, residues 263-342
Plasmid#180624PurposeBacterial expression for SNX15 MIT residues 263-342. Has N-terminal HIS-GST tag. Internal ID:WISP21-130.DepositorAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA528 SNX15 MIT residues 263-342
Plasmid#180625PurposeBacterial expression for SNX15 MIT residues 263-342. Has N-terminal HIS-SUMO tag. Internal ID:WISP21-14DepositorAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA528 USP8, residues 1-147
Plasmid#180636PurposeBacterial expression for USP8 MIT domain, residues 1-147. Has N-terminal HIS-SUMO tag. Internal ID: WISP20-86.DepositorAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET16B VPS4A, residues 1-84
Plasmid#180638PurposeBacterial expression for VPS4A MIT domain residues 1-84. Has N-terminal HIS-TAG. Internal ID: WISP05-43DepositorAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only