We narrowed to 18,518 results for: Jun
-
Plasmid#226476PurposepMOLC360_VL_I1 (Chloramphenicol R) containing the insert I1 to be assembled in POC1518 (pMOBK360_VL) using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1536
Plasmid#226477PurposepMOLC360_VM_I2 (Chloramphenicol R) containing the insert I2 to be assembled in POC1518 (pMOBK360_VL) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1537
Plasmid#226478PurposepMOLC360_VM_I3 (Chloramphenicol R) containing the insert I3 to be assembled in POC1518 (pMOBK360_VL) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1538
Plasmid#226479PurposepMOLC360_VR_I4 (Chloramphenicol R) containing the insert I4 to be assembled in POC1518 (pMOBK360_VL) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1539
Plasmid#226480PurposepMOLC360_VL_I5 (Chloramphenicol R) containing the insert I5 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1540
Plasmid#226481PurposepMOLC360_VM_I6 (Chloramphenicol R) containing the insert I6 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1541
Plasmid#226482PurposepMOLC360_VR_I7 (Chloramphenicol R) containing the insert I7 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1542
Plasmid#226483PurposepMOLC360_VL_I8 (Chloramphenicol R) containing the insert I8 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1543
Plasmid#226484PurposepMOLC360_VR_I9 (Chloramphenicol R) containing the insert I9 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1544
Plasmid#226485PurposepMOLC360_VL_I10 (Chloramphenicol R) containing the insert I10 to be assembled in POC1520 (pMOBK360_VR) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1545
Plasmid#226486PurposepMOLC360_VR_I11 (Chloramphenicol R) containing the insert I11 to be assembled in POC1520 (pMOBK360_VR) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1426
Plasmid#221573PurposePlasmid containing the Insert 1 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1427
Plasmid#221574PurposePlasmid containing the Insert 2 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1428
Plasmid#221575PurposePlasmid containing the Insert 3 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1429
Plasmid#221576PurposePlasmid containing the Insert 4 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB027
Plasmid#234636PurposepET-28a(+) based plasmid for expression of H16_B1102 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB028
Plasmid#234637PurposepET-28a(+) based plasmid for expression of H16_B1148 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB029
Plasmid#234638PurposepET-28a(+) based plasmid for expression of H16_B1264 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB030
Plasmid#234639PurposepET-28a(+) based plasmid for expression of H16_B1335 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB026
Plasmid#234635PurposepET-28a(+) based plasmid for expression of H16_A3514 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mNeonGreen-G418
Plasmid#236484PurposePlasmid for deleting or C-terminally tagging endogenous genes with mNeonGreen and selection on G418.DepositorInsertmNeonGreen
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mStayGold-Hyg
Plasmid#236486PurposePlasmid for deleting or C-terminally tagging endogenous genes with mStayGold and selection on Hyg.DepositorInsertmStayGold
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mStayGold-Nat
Plasmid#236485PurposePlasmid for deleting or C-terminally tagging endogenous genes with mStayGold and selection on Nat.DepositorInsertmStayGold
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mStayGold-G418
Plasmid#236487PurposePlasmid for deleting or C-terminally tagging endogenous genes with mStayGold and selection on G418.DepositorInsertmStayGold
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mCherry-Nat
Plasmid#236488PurposePlasmid for deleting or C-terminally tagging endogenous genes with mCherry and selection on Nat.DepositorInsertmCherry
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-sfGFP-Hyg
Plasmid#236480PurposePlasmid for deleting or C-terminally tagging endogenous genes with sfGFP and selection on Hyg.DepositorInsertsfGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mCherry-G418
Plasmid#236490PurposePlasmid for deleting or C-terminally tagging endogenous genes with mCherry and selection on G418.DepositorInsertmCherry
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mScarlet-Nat
Plasmid#236491PurposePlasmid for deleting or C-terminally tagging endogenous genes with mScarlet and selection on Nat.DepositorInsertmScarlet
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mCherry-Hyg
Plasmid#236489PurposePlasmid for deleting or C-terminally tagging endogenous genes with mCherry and selection on Hyg.DepositorInsertmCherry
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-Dendra2-G418
Plasmid#236496PurposePlasmid for deleting or C-terminally tagging endogenous genes with Dendra2 and selection on G418.DepositorInsertDendra2
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-GFP-Nat
Plasmid#236476PurposePlasmid for deleting or C-terminally tagging endogenous genes with GFP and selection on Nat.DepositorInsertGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-Dendra2-Hyg
Plasmid#236495PurposePlasmid for deleting or C-terminally tagging endogenous genes with Dendra2 and selection on Hyg.DepositorInsertDendra2
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mNeonGreen-Hyg
Plasmid#236483PurposePlasmid for deleting or C-terminally tagging endogenous genes with mNeonGreen and selection on Hyg.DepositorInsertmNeonGreen
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mScarlet-G418
Plasmid#236493PurposePlasmid for deleting or C-terminally tagging endogenous genes with mScarlet and selection on G418.DepositorInsertmScarlet
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mScarlet-Hyg
Plasmid#236492PurposePlasmid for deleting or C-terminally tagging endogenous genes with mScarlet and selection on Hyg.DepositorInsertmScarlet
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-GFP-Hyg
Plasmid#236477PurposePlasmid for deleting or C-terminally tagging endogenous genes with GFP and selection on Hyg.DepositorInsertGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-sfGFP-Nat
Plasmid#236479PurposePlasmid for deleting or C-terminally tagging endogenous genes with sfGFP and selection on Nat.DepositorInsertsfGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mNeonGreen-Nat
Plasmid#236482PurposePlasmid for deleting or C-terminally tagging endogenous genes with mNeonGreen and selection on Nat.DepositorInsertmNeonGreen
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-GFP-G418
Plasmid#236478PurposePlasmid for deleting or C-terminally tagging endogenous genes with GFP and selection on G418.DepositorInsertGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
NarP-GFP
Plasmid#220161PurposeTo track the natural NarP promoter's transcriptional dynamicsDepositorInsertNarP promoter only
ExpressionBacterialAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH912
Plasmid#230855PurposeEf1a-DivA-BE3-T2A-BlastR-wPREDepositorInsertDivA-BE3
UseLentiviralExpressionMammalianAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH643
Plasmid#230834Purposehu6-BsmBI-MS2_sgRNA-Ef1a-puroR-T2A-mCherry-wPREDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH394
Plasmid#230851PurposeEf1a-rAPOBEC1-dCas9-T2A-BlastR-wPREDepositorInsertrAPOBEC1-dCas9
UseLentiviralExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH398
Plasmid#230854PurposeEf1a-rAPOBEC1-n'Cas9-T2A-BlastR-wPREDepositorInsertrAPOBEC1-n'Cas9
UseLentiviralExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH905
Plasmid#230844PurposeEf1a-PmCDA1-BE3-T2A-tagBFP-wPREDepositorInsertPmCDA1-BE3
UseLentiviralExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH401
Plasmid#230852PurposeEf1a-rAPOBEC1-nCas9-T2A-BlastR-wPREDepositorInsertrAPOBEC1-nCas9
UseLentiviralExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH903
Plasmid#230857PurposeEf1a-PmCDA1-BE3-T2A-BlastR-wPREDepositorInsertPmCDA1-BE3
UseLentiviralExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-ATM HRD
Plasmid#207085PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous ATM locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human ATM locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD3 HRD
Plasmid#207077PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD3 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD3 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only