We narrowed to 44,064 results for: tro
-
Plasmid#69905PurposeExpresses the human HIPK3 exon 2 circular RNA in mammalian cellsDepositorInsertHIPK3 (HIPK3 Human, Fly)
ExpressionMammalianMutationExpresses aa1-194 of HIPK3PromoterCMVAvailable SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-TetR
Plasmid#103798PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-SECFP-Galectin3
Plasmid#64150PurposeExpression in mammalian cells (production of retrovirus vector)DepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
iSH-iRFP670-sspB
Plasmid#176102PurposeHeterodimerization with iLID, phosphatidylinositol 3-kinase derived iSHDepositorInsertphosphatidylinositol 3-kinase (Pik3r1 Mouse)
ExpressionMammalianAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Flag-Rab35 Q67L active
Plasmid#47428DepositorAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
Flag-Rab35 S22N inactive
Plasmid#47429DepositorAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
PU.1-ets-IRES-mCherry
Plasmid#80141Purposeretroviral expression of PU.1-ets (competitive inhibitor of PU.1) and mCherryDepositorInsertPU.1 (Spi1 Mouse)
UseRetroviralTagsIRES-mCherryExpressionMammalianMutationets = PU.1 DNA binding domain (amino acids 159-26…Available SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ΔN-RNMT
Plasmid#112708PurposeExpresses FLAG-NES-RNMT 121-476 D203A ("ΔN-RNMT") in mammalian cells. Overexpression inhibits cytoplasmic cap methylation.DepositorInsertRNMT (RNMT Human)
TagsFLAG and HIV Rev nuclear export signal (NES)ExpressionMammalianMutationdeleted amino acids 2-120, mutated active-site D2…PromoterCMVAvailable SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-NRAS
Plasmid#52728Purposeretroviral expression of human NRASDepositorAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-TetR
Plasmid#103813PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-CDC34
Plasmid#52731Purposeretroviral expression of human CDC34DepositorAvailable SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
nes714tk/lacZ
Plasmid#47614Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron fragment (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation714 bp from 3' end of 2nd intronPromoterHSV tk promoterAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-TetR
Plasmid#103797PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMT[Hygro]_GBP-3xFlag-DEST
Plasmid#157813PurposeA gateway plasmid for expression of GBP-3xFlag-fusion protein under the regulation of the copper-inducible metallothionein promoter in Drosophila cells; suitable for hygromycin selectionDepositorInsertGFP-binding protein
UseFor drosophila cellsTags3xFlagExpressionInsectPromotermetallothioneinAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmKikGR Actin
Plasmid#105315PurposePhotoconvertable cytoskeletal protein actin to study kinetics or dynamicsDepositorAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
nes1852tk/lacZ
Plasmid#47613Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation2nd intron onlyPromoterHSV tk promoterAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 tTA SDHA
Plasmid#177976PurposeAll-in-one dox-repressible expression of cDNADepositorInsertSDHA (SDHA Human)
UseLentiviralExpressionMammalianMutationSilent point mutations to SDHA sgRNA targetAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMY-Lyz2-GSG-mVenus
Plasmid#163348PurposeRetroviral vector to express C-terminally mVenus-tagged murine Lyz2DepositorAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMY-Lyz2-GSG-mTurquoise
Plasmid#163347PurposeRetroviral vector to express C-terminally mTurquoise2-tagged murine Lyz2DepositorAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-3xHA-NHL only-LIN-41
Plasmid#52723Purposeretroviral expression of human LIN-41 / TRIM71 containing only the NHL repeats and 3 N-terminal HA tagsDepositorInsertLIN-41 (TRIM71 Human)
UseRetroviralTags3xHAExpressionMammalianMutationNHL-only contains only an initiating methionine a…Available SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-3xHA-7CtoA-LIN-41
Plasmid#52726Purposeretroviral expression of human LIN-41 / TRIM71 containing cysteine to alanine point mutations of all 7 cysteines in the RING domain and 3 N-terminal HA tagsDepositorInsertLIN-41 (TRIM71 Human)
UseRetroviralTags3xHAExpressionMammalianMutationchanged cysteines 12, 15, 61, 66, 69, 91, and 94 …Available SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-HIPK3 Exon
Plasmid#69888PurposeExpresses the human HIPK3 exon 2 circular RNA in DrosophilaDepositorInsertHIPK3 (HIPK3 Human, Fly)
ExpressionInsectMutationExpresses aa1-194 of HIPK3PromoterMetallothionein Promoter (pMT)Available SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HA-NL2/1dWW-RM IRES mCherry
Plasmid#249597PurposeExpress NL2 - NL1 chimera, mutating amino acids 779-782 (PPDY -> AAAA), resistant to shRNA (RM)DepositorInsertNlgn2 (Nlgn2 Mouse)
TagsHAExpressionMammalianMutationChimeric protein of NL2 extracellular domain, wit…Available SinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-opEbu1
Plasmid#240702PurposeRSF1010 origin of replication plasmid containing Ebu1 recombitron with extended a1 a2 regions with a donor in the ncRNA targeting lacZ locus in Citrobacter freundii ATCC 8090 expressed by Pm promoterDepositorInsertEbu1 RT, Ebu1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationExtended a1 a2 regionsAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Non-Targeting
Plasmid#241026PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of a non-targeting sgRNA; used as control for SaCas9 based knock-outs in murine astrocytesDepositorInsertU6 driven empty sgRNA
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha2_BeYDV geminino 2.0 (no ATG)-eGFP (GB5178)
Plasmid#225443PurposeGeminino 2.0-no ATG on CDS. BeYDV LIR1 + 2nd half intron ICON MP + eGFP w/o ATG + t35S:SIR + P35s + 1st half of intron from ICON MP + BeYDV LIR1.DepositorInsertBeYDV LIR1 + 2nd half intron ICON MP + eGFP w/o ATG + t35S:SIR + P35s + 1st half of intron from ICON MP + BeYDV LIR1
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCav1 in pT3TS-Dest
Plasmid#194293PurposeIn vitro transcription of mKate2 tagged zebrafish caveolin1 from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone KZWDepositorInsertcaveolin (cav1.S Frog)
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMY-Lyz2-GSG-mCherry
Plasmid#163346PurposeRetroviral vector to express C-terminally mCherry-tagged murine Lyz2DepositorAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Bcan-Ntrk1_4
Plasmid#136413PurposeLentiviral expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Bcan)_U6_sgRNA(Ntrk1)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Myb-Qk_1
Plasmid#136415PurposeLentiviral expression of gRNAs targeting intron 4 of murine Qk and intron 9 of murine Myb. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Myb)_U6_sgRNA(Qk)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-lyzC-mcherry-2a-CDK2-D145N
Plasmid#121132Purposeneutrophil specific expressionDepositorInsertdre-D145N CDK2 DN (cdk2 Zebrafish)
Tagsmcherry-2aExpressionBacterialMutationD145N point mutation DNPromoterneutrophil specific lyzCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Bod1l_Sense
Plasmid#124443PurposePlasmid for sense in situ probe in vitro transcriptionDepositorInsertBiorientation of chromosomes in cell division 1-like (Bod1l Mouse)
UseIn situ probePromoterT7Available SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDX2 ObLiGaRe Donor vector/EPB64
Plasmid#90017PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to CDX2 exon1 locusDepositorInsertMCS flanked by inverted CDX2 ZFN binding sites (CDX2 Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCXIB-FLAG-hDIXDC1-L-S592A
Plasmid#61225PurposeRetrovirus expressing long isoform of human DIXDC1DepositorAvailable SinceMarch 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Hygro-FLAG-hDIXDC1 S592A
Plasmid#61214PurposeRetrovirus expressing long isoform of human DIXDC1DepositorAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
nes714Δ1388-1507tk/lacZ
Plasmid#47616Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron fragment (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation714 bp from 3' end of 2nd intron with a dele…PromoterHSV tk promoterAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
SSpB-iRFP-p63DH
Plasmid#176120PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBactin-mOrange2-NEDD1-gTBD
Plasmid#196858PurposeExpression of the gamma-tubulin-binding domain (gTBD) of NEDD1 fused to mOrange. Used to displace endogenous gamma-TuRC from the centrosome.DepositorInsertmOrange2-N-gTBD (NEDD1 Human)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only