We narrowed to 11,344 results for: cat.1
-
Plasmid#142864PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only
-
TFORF2169
Plasmid#141955PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2223
Plasmid#141978PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2827
Plasmid#143632PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0344
Plasmid#141587PurposeLentiviral vector for overexpressing the ETF1 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0343
Plasmid#141586PurposeLentiviral vector for overexpressing the ETF1 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0342
Plasmid#141585PurposeLentiviral vector for overexpressing the ETF1 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-hPIKfyve
Plasmid#121148PurposeExpresses GFP-tagged human PIKfyve in mammalian cells.DepositorInsert1-phosphatidylinositol 3-phosphate 5-kinase isoform 2 (PIKFYVE Human)
TagsGFPExpressionMammalianPromoterCMVAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Gria1-GFP KI
Plasmid#131489PurposeEndogenous tagging of GluA1: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN R255E-HA
Plasmid#186894PurposeDoxycycline-dependent expression of human cGAS gene (with R255E mutation) in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with R255E mutation and C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncation, R255EPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX_TRC311/NLS-Cas13d-P2A-Blast
Plasmid#212196PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40DepositorInsertCasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
UseCRISPR and LentiviralTagsHA, NLS, and blasticidin S deaminaseExpressionMammalianPromoterEF-1α promoterAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB CAG SMARCA4-IRES-EGFP
Plasmid#153948PurposepiggyBac transposon vector with CAG promoter expressing wild-type SMARCA4 (FLAG-tagged) and EGFPDepositorAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-FLTID-GSQ-PMLivaWT-P2A-BLAST
Plasmid#208040PurposeEnables constitutive expression of N-terminal TurboID-fused PML (isoform IVa; WT); selection with blasticidinDepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTetOne-FLAG-human cGASdeltaN-HA
Plasmid#186899PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal FLAG and C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsFLAG and HAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB CAG SMARCA4 T910M-Venus
Plasmid#153951PurposepiggyBac transposon vector with CAG promoter expressing SMARCA4 (T910M mutant)-Venus fusion proteinDepositorAvailable SinceAug. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB CAG SMARCA4 T910M-IRES-EGFP
Plasmid#153949PurposepiggyBac transposon vector with CAG promoter expressing T910M mutant SMARCA4 (FLAG-tagged) and EGFPDepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
AURKB gRNA (BRDN0001149202)
Plasmid#77617Purpose3rd generation lentiviral gRNA plasmid targeting human AURKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_UPF3A/UPF3B (pAVA3129)
Plasmid#239329PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting UPF3A and UPF3BDepositorInsertU6-driven sgRNA1 targting UPF3A and 7SK-driven sgRNA2 targeting UPF3B (UPF3B Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-FLAG-human cGASdeltaN-GFP
Plasmid#186879PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal FLAG and C-terminal GFP fusion (Adamts1 Human, Synthetic)
UseRetroviralTagsFLAG and GFPMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN-OMM
Plasmid#186881PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal MAVS transmembrane domain (503-541 a.a.) fusion (Adamts1 Human, Synthetic)
UseRetroviralMutationN-terminal truncation, MAVS transmembrane domain …PromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN-Pex
Plasmid#186882PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal PEX13 transmembrane domain (136-233 a.a.) fusion (Adamts1 Human, Synthetic)
UseRetroviralMutationN-terminal truncation, PEX13 transmembrane domain…PromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN-ER
Plasmid#186883PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal VAMP2 transmembrane domain (86-119 a.a.) fusion (Adamts1 Human, Synthetic)
UseRetroviralMutationN-terminal truncation, VAMP2 transmembrane domain…PromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-human cGASdeltaN-OMM
Plasmid#186887PurposeExpression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal MAVS transmembrane domain fusion (Adamts1 Human, Synthetic)
UseLentiviralMutationN-terminal truncation, MAVS transmembrane domain …PromoterCMVAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:156-522aa-HA
Plasmid#186856PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (156-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:158-522aa-HA
Plasmid#186857PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (158-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:162-522aa-HA
Plasmid#186858PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (162-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:164-522aa-HA
Plasmid#186859PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (164-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:166-522aa-HA
Plasmid#186860PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (166-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-FLAG-human cGASdeltaN-HA
Plasmid#186848PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal FLAG and C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsFLAG and HAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN C396/397A-HA
Plasmid#186850PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with DNA binding mutantation C396/397A) and C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncation, C396A, C397APromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:154-522aa-HA
Plasmid#186855PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (154-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-His6-ODC-Ctag
Plasmid#163614PurposeExpresses truncated human Ornithine Decarboxylase in bacterial cells for binding to Ornithine Decarboxylase Antizyme.DepositorAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
SUMO_MT3
Plasmid#200303PurposeBacterial expression plasmids for production of recombinant metallothionein 3 containing N-terminal tags, which can be cleaved later: His-tag for purification and SUMO-tag for better solubilityDepositorAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCM167-Venus-VF-hADAM10(aa1-459)
Plasmid#189559PurposeProtein expression ADAM10 in mammalian cells. Contains prodomain and metalloprotease domain--amino acids 1-459DepositorInserttruncated ADAM metallopeptidase domain 10 (ADAM10 Human)
TagsVFExpressionMammalianMutationcontains aa 1-459Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-V5-DEST-hADAM10(aa1-213)-GST
Plasmid#189562PurposeProtein expression ADAM10 in mammalian cells. Contains only prodomain--amino acids 1-213DepositorInserttruncated ADAM metallopeptidase domain 10 (ADAM10 Human)
TagsGSTExpressionMammalianMutationcontains aa 1-213Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Bambi NGFR
Plasmid#44628DepositorAvailable SinceApril 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS2
Plasmid#174302PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #2 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS3
Plasmid#174303PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #3 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3296
Plasmid#144772PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0481
Plasmid#142638PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3297
Plasmid#144773PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3158
Plasmid#144634PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0597
Plasmid#142655PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0480
Plasmid#143705PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0598
Plasmid#142656PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3085
Plasmid#144561PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
ABL1-C-HiBiT
Plasmid#234568PurposeBacterially expressed ABL1-C-HiBiT for Ni-NTA purificationDepositorInsertAbelson Kinase Domain (ABL1 Human)
TagsHiBiT Tag-thrombin site-10xHis and T7 gene 10 lea…ExpressionBacterialMutationCodon optimized for bacterial expressionPromoterT7Available SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based no force control)
Plasmid#118722PurposeThe donor (YPet(short)) only control for the no force control of the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-FL-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only