We narrowed to 7,219 results for: cas9 plasmid
-
Plasmid#160729PurposeSingle-plasmid V. cholerae CAST system. Encodes all proteins, crRNA, donor DNA; non-targeting crRNA has BsaI sites for cloning. Temperature-sensitive pSC101* backbone can be cured by 37 °C incubation.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPEmax-Hygro
Plasmid#214020Purposeinducible PEmax system for controllable prime editing; this plasmid is used to insert PEmax prime editor in one allele of AAVS1 locusDepositorInsertPEmax
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPE2-Hygro
Plasmid#214019Purposeinducible PE2 system for controllable prime editing; this plasmid is used to insert PE2 prime editor in one allele of AAVS1 locusDepositorInsertPE2
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.4.hSyn.H2B.RFP
Plasmid#170387PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.4.hSyn.flex.H2B.RFP
Plasmid#170386PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.flex.H2B.RFP
Plasmid#170374PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.H2B.RFP
Plasmid#170370PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.flex.H2B.RFP
Plasmid#170376PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.H2B.RFP
Plasmid#170372PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTubb3-MC
Plasmid#87112Purposeminicircle parental backbone plasmid including GFP knock-in donor targeting Tubb3 gene and one cutting site for HITIDepositorInsertGFP
UseCRISPRAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP
Plasmid#112677PurposeAn AAV vector that expresses a Cre-dependent nuclear-localized Red to Green Fluorescent proteinDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertNuclear-localized floxed-mCherry EGFP
UseAAVTagsNuclear localization signalPromoterEF1aAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR
Plasmid#60230PurposeExpresses Cre recombinase and KASH-tagged EGFP from the hSyn promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Cre recombinase
EGFP
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HA-P2A and EGFP-KASHExpressionMammalianPromoterU6 and hSynAvailable SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
Plasmid#60225PurposeExpresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA targeting LacZ. AAV backbone.DepositorInsertssgRNA
Renilla luciferase
Cre recombinase
UseAAV, CRISPR, Cre/Lox, Luciferase, and Mouse Targe…TagsCre-HA and Rluc-P2AExpressionMammalianPromoterEFS and U6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1442 - pAAV CMV-IE Nuc-iRFP-2A-iCre
Plasmid#112683PurposeAn AAV vector that expresses a nuclear-localized iRFP713 reporter and improved Cre recombinaseDepositorInsertiRFP713
UseAAVTags2A-iCre and Nuclear localization signalPromoterCMV-IEAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1440 - pAAV CMV-IE Nuc-iRFP-2A-Flpo
Plasmid#112684PurposeAn AAV vector that expresses a nuclear-localized iRFP713 reporter and optimized Flp recombinaseDepositorInsertiRFP713
UseAAVTags2A-Flpo and Nuclear localization signalPromoterCMV-IEAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1179 - pAAV (flox-stop) TH gRNA A EF1a eGFP
Plasmid#113158PurposeAn AAV vector that expresses a Cre-dependent guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV, CRISPR, and Cre/LoxExpressionMammalianPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
Plasmid#113156PurposeAn AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporterDepositorInsertTwo gRNAs for rat Rosa26
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1088 - pAAV TH gRNA A+B pair EF1a EGFP
Plasmid#113155PurposeAn AAV vector that expresses guide RNAs targeting rat TH and expresses EGFP reporterDepositorInsertTwo gRNAs for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1388 - pAAV MANF gRNA A+B EF1a EGFP
Plasmid#113157PurposeAn AAV vector that expresses guide RNAs targeting rat MANF and expresses EGFP reporterDepositorInsertTwo gRNAs for rat MANF
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMBEC6
Plasmid#187598PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Gentamycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMBEC2
Plasmid#187596PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Kanamycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMBEC8
Plasmid#187599PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Apramycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPSG779
Plasmid#239532PurposeCRISPR plasmid withCas9 and sgRNA targeting YBR197C locus in S. cerevisiaeDepositorInsertsgRNA_YBR197C
UseCRISPRAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
ABEmax-Puro V2
Plasmid#226955PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABEmax-Puro V3
Plasmid#226956PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTox-EGFPsite1_NGG-PAM (BPK740)
Plasmid#181746Purposep11-lacY-wtx1 derivative toxic plasmid encoding an SpCas9 target site for EGFP site 1 with an NGG PAMDepositorInsertccdB toxin gene and SpCas9 target site (EGFP site 1 NGG PAM)
UseSelection plasmidAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTox-EGFPsite1_NGA-PAM (BPK754)
Plasmid#181747Purposep11-lacY-wtx1 derivative toxic plasmid encoding an SpCas9 target site for EGFP site 1 with an NGA PAMDepositorInsertccdB toxin gene and SpCas9 target site (EGFP site 1 NGA PAM)
UseSelection plasmidAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.25
Plasmid#246894PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for UBAP2L Nterm.DepositorInsertUBAP2L Nterm Guide RNA 1 (UBAP2L Human)
ExpressionMammalianAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHelper_ShCAST_sgRNA
Plasmid#127921PurposeExpresses ShCAST and an empty sgRNA scaffold. New targets can be added using Golden Gate assembly (LguI sites).DepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA scaffold for guide cloning (LguI sites)
Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
ePE2
Plasmid#202029PurposePrime Editing plasmid for tag insertionDepositorInsertCas9,
UseCRISPRExpressionPlantAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgCtr- LentiCRISPRv2
Plasmid#107402PurposeLentiviral expression of Cas9 and a control gRNADepositorInsertcontrol gRNA
UseLentiviralAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHelp
Plasmid#227583PurposeAccessory plasmid with a sgRNA cassette for Cas9, and ampicillin resistanceDepositorInsertguide RNA scaffold
UseCloning vectorAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-scr
Plasmid#169795PurposeExpresses Cas9 and guide RNA with untarget sequence generated by scramble of the target sequence of LentiCRISPRv2-ACTB-C1..DepositorInsertScrambled guide RNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCgsgRNA_crtYf
Plasmid#153338PurposeDouble-plasmid-based CRISPR-Cas9 system in Corynebacterium glutamicum; rep oriVC. glutamicum; pMB1 oriVE. Coli; Pj23119-crRNA targeting crtYf; SpcrDepositorInsertcrRNA targeting crtYf
UseCRISPRExpressionBacterialAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
7i sgRNA for 4-μHOM reporter
Plasmid#113626PurposesgRNA/CAS9 expression plasmid to induce a 3’ double-strand break in the 4-μHOM reporter 8 nts. upstream from the microhomologyDepositorInsert7i sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
7h sgRNA for 4-μHOM reporter
Plasmid#113625PurposesgRNA/CAS9 expression plasmid to induce a 3’ double-strand break in the 4-μHOM reporter at the edge of the microhomology.DepositorInsert7h sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEC726
Plasmid#190814PurposeCRISPRi backbone plasmid harboring BbsI sites for easy cloning of sgRNA targeting regions via Golden gate.DepositorInsertdCas9
UseCRISPR and Synthetic BiologyMutationS. pyogenes dCas9 codon optimized for Streptomyce…PromoterSP30Available SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ACTB-C1
Plasmid#169796PurposeExpresses Cas9 and guide RNA for ACTB gene in humanDepositorInsertguide RNA for ACTB gene
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT9748-dCBE
Plasmid#163008Purposeplasmid expressing CBE with dCas9DepositorInsertdCBE
UseCRISPRTags3xFLAG and SV40 NLSExpressionMammalianPromoterEF1-aAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUF-AsCpf1-pre-gRNA
Plasmid#137849PurposeAsCpf1 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorInsertAsCpf1 and pre-gRNA cassette
UseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUF-LbCpf1-pre-gRNA
Plasmid#137848PurposeLbCpf1 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorInsertLbCpf1-NLS-FLAG and gRNA cassette
UseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJT25_GalL_BE3
Plasmid#143736PurposeExpresses BE3 in yeast cellsDepositorInsertBE3
UseCRISPRExpressionYeastMutationspCas9(D10A)PromoterGalLAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pgRNAtet-phaZ
Plasmid#169874PurposeSingle guide RNA plasmid for Cas9 targeting phaZ in P. putidaDepositorInsertsgRNA towards phaZ in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNAkan-glpR
Plasmid#169873PurposeSingle guide RNA plasmid for Cas9 targeting glpR in P. putidaDepositorInsertsgRNA towards glpR in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJT42_GalL_BE-PAPAPA
Plasmid#145035PurposeExpresses BE-PAPAPA in yeast cellsDepositorInsertBE-PAPAP
UseCRISPRExpressionYeastMutationspCas9(D10A)PromoterGalLAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJT23_GalL_BE-PAPAP
Plasmid#143486PurposeExpresses BE-PAPAP in yeast cellsDepositorInsertBE-PAPAP
UseCRISPRExpressionYeastMutationspCas9(D10A)PromoterGalLAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
nSpG UGI Puro
Plasmid#235046PurposeControl nickase Cas9DepositorInsertnCas9
UseCRISPR and LentiviralTagsP2A-PuroRPromoterEF1a coreAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only