We narrowed to 7,219 results for: cas9 plasmid
-
Plasmid#100941PurposeSingle chain variable fragment antibody GCN4 fused to DNMT3a, binds SunTag, with 3xTy1 tagDepositorInsertscFvGCN4, sfGFP, GB1, DNMT3a catalytic domain (DNMT3A Synthetic, Human)
Tags1xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgRNA_expression_vector
Plasmid#210212PurposeAn empty gRNA expression vector to clone U6 promoter driven sgRNAs with gRNA scaffold and with co-expression of DsRed. sgRNA can be cloned by Golden Gate Assembly or restriction digestion using BbsI.DepositorTypeEmpty backboneExpressionBacterial and MammalianPromoterU6Available SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
miniCGBE1-SpRY (pBM1571)
Plasmid#170105PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-SpRY-nCas9(D10A)-P2A-EGFPDepositorInsertrAPOBEC1(R33A)-SpRY-nCas9(D10A)-P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationR33A in rAPOBEC1 and SpRY-nCas9 (D10A/A61R/L1111R…PromoterCMVAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP323-pAAV-FullH1TO-SaCa9gRNAi(SapI)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113700PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in a gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ABE-NT-sgRNA
Plasmid#112734PurposeAAV inverted terminal repeat based vector plasmid encoding E. coli TadA, the N-terminal half of nCas9 and sgRNADepositorInsertABE-NT-sgRNA
UseAAVAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-CBE N-terminal
Plasmid#137175PurposeAAV genome: expresses the N-terminal of v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE N-terminal; U6-protospacer
UseAAVMutationCas9 D10APromoterCbhAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc
Plasmid#208382PurposeDerived from LentiCRISPRV2 by replacing Cas9 with Cre recombinase and puromycin resistance with GpNLuc. Contains a stuffer sequence for cloning of sgRNA of interest, as per LentiCRISPRV2.DepositorTypeEmpty backboneUseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6d
Plasmid#207854PurposeMammalian expression of PE6d prime editorDepositorInsertPE6d
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationM-MLVRTDRNAseHrt(T128N, V223Y, D200C)Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330A-nBRD4/PITCh
Plasmid#91794PurposePITCh sgRNA, N-terminal BRD4 sgRNA, and Cas9 expressing plasmid for use with the dTAG knock-in system and BRD4DepositorInsertSpCas9
UseCRISPRExpressionMammalianPromoterchicken β-actin promoterAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6a
Plasmid#207851PurposeMammalian expression of PE6a prime editorDepositorInsertPE6a
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationEc48rt(E60K, K87E, E165D, D243N, R267I, E279K, K3…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PEmaxRNaseHtrunc
Plasmid#207858PurposeMammalian expression of PEmaxDRNaseH prime editorDepositorInsertPEmaxDRNaseH
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationM-MLVRTDRNAseHrtAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-FOXL2-cterm
Plasmid#192893PurposeExpresses Cas9 and sgRNA targeting the C-terminus region of FOXL2DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28b-zDjCas13d-His
Plasmid#234481PurposePlasmid for bacterial expression and purification of DjCas13d protein (zebrafish codon-optimized)DepositorInsertDjCas13d
UseCRISPRTags6xHisExpressionBacterialAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330 Pten
Plasmid#59909PurposepX330 backbone expressing sgRNA targeting Pten to edit mouse Pten. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-NPM1-gRNA for U2OS
Plasmid#238250PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to NPM1 locusDepositorInsertNPM1
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.1
Plasmid#59911PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
SPACE (pRZ1813)
Plasmid#140242PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9-pmCDA1(R187W)-UGI-UGI-P2A-EGFPDepositorInsertSPACE
ExpressionMammalianMutationV82G in TadA*, D10A in Cas9, R187W in pmCDA1PromoterCMVAvailable SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgAAVS1
Plasmid#85802PurposeCas9/CRISPR vector for cut at human AAVS1 gene intron1DepositorInsertPPP1R12C (PPP1R12C Human)
ExpressionMammalianAvailable SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-SRRM2-gRNA
Plasmid#238251PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to SRRM2 locusDepositorInsertSRRM2
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE N-terminal
Plasmid#137182PurposeAAV genome: expresses the N-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, U6-sgRNADepositorInsertv5 AAV-saCBE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hCRY1 c-term
Plasmid#179453PurposeLentiviral Crispr/Cas9 plasmid targeting hCRY1 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human CRY1
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgFXN-1
Plasmid#246017PurposeAll-in-one CRISPRko plasmid containing Cas9 and guide RNA targeting FXNDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgFXN-2
Plasmid#246018PurposeAll-in-one CRISPRko plasmid containing Cas9 and guide RNA targeting FXNDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hPER2c-term #1
Plasmid#179454PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hPER2c-term #2
Plasmid#179455PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hPER2c-term #3
Plasmid#179456PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
SunTag-FWAgRNA-4-14aa-TET1cd
Plasmid#106436PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the FWA promoterDepositorInsertgRNA4_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN414aa_OCS (TET1 Mustard Weed, Synthetic, Human)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
SPACE-ΔUGI (pRZ1836)
Plasmid#140243PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9-pmCDA1(R187W)-P2A-EGFPDepositorInsertSPACE-ΔUGI
ExpressionMammalianMutationV82G in TadA*, D10A in Cas9, R187W in pmCDA1PromoterCMVAvailable SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDonor MAFA-P2A-tdTomato
Plasmid#246654PurposeDonor plasmid for Crispr/Cas9 gene editing of the human MAFA locusDepositorInsertP2A-tdTomato flanked by MAFA homology regions (MAFA Synthetic, Human)
UseCRISPRExpressionMammalianAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDonor AVIL-P2A-iCre
Plasmid#246652PurposeDonor plasmid for Crispr/Cas9 gene editing of the human AVIL locusDepositorInsertP2A-iCre flanked by AVIL homology regions (AVIL Synthetic, Human)
UseCRISPRExpressionMammalianAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-NPM1-gRNA for HCT116
Plasmid#238249PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to NPM1 locusDepositorInsertNPM1
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWZ157
Plasmid#163639Purposepcn-1>PCN-1::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZ186
Plasmid#163641Purposerps-27>DHB::2xmKate2 expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB:2xmKate2::3xHA
UseCRISPRTags2xmKate2ExpressionWormPromoterrps-27Available SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ARL13B
Plasmid#227276PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of ARL13B for knock-in.DepositorInsertsgRNA Targeting C-terminus of ARL13B (ARL13B Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-GOLGA2
Plasmid#207791PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of GOLGA2 for knock-in.DepositorInsertsgRNA Targeting N-terminus of GOLGA2 (GOLGA2 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV-SauriABE8e
Plasmid#189927PurposePlasmid encoding SauriABE8e driven by the CMV promoter for plasmid transfection.DepositorInsertSauriABE8e
ExpressionMammalianMutationNme2Cas9 D16APromoterCMVAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-CjABE8e
Plasmid#189929PurposePlasmid encoding CjABE8e driven by the CMV promoter for plasmid transfection.DepositorInsertCjABE8e
ExpressionMammalianMutationCjCas9 D8APromoterCMVAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TOMM20
Plasmid#207789PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of TOMM20 for knock-in.DepositorInsertsgRNA Targeting C-terminus of TOMM20 (TOMM20 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-LAMP1
Plasmid#207787PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of LAMP1 for knock-in.DepositorInsertsgRNA Targeting C-terminus of LAMP1 (LAMP1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only