We narrowed to 4,052 results for: plasmid lenti crispr
-
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-1- LentiCRISPRv2
Plasmid#107403PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-2- LentiCRISPRv2
Plasmid#107404PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1 sgTollip
Plasmid#196546PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.DepositorAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_1
Plasmid#138324PurposeExpress guide RNA 2 for mouse MycDepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_2
Plasmid#138346PurposeExpress guide RNA 1 for mouse MycDepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgSORCS2-G2
Plasmid#118416PurposeCRISPR knockout, expresses Cas9, and sgRNA targeting Human SORCS2DepositorInsertgRNA SORCS2 Human (SORCS2 Human)
UseCRISPR and LentiviralAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g2 LentiCRISPRv2-mCherry
Plasmid#218663PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g1 LentiCRISPRv2-mCherry
Plasmid#218662PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-dCas9
Plasmid#112233PurposeLentiviral plasmid for expression of gRNA and dCas9 in mammalian cells; derivative of lentiCRISPR v2DepositorInsertsdCas9
Porumycin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationChanged: Aspartic acid 10 to Glycine, Histidine 8…PromoterEFS-NSAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgFXN-1
Plasmid#246017PurposeAll-in-one CRISPRko plasmid containing Cas9 and guide RNA targeting FXNDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgFXN-2
Plasmid#246018PurposeAll-in-one CRISPRko plasmid containing Cas9 and guide RNA targeting FXNDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-CRISPR
Plasmid#85402PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes with constitutive Cas9 expressionDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2 neo
Plasmid#98292PurposeVariant of lentiCRISPRv2 that confers G418 resistanceDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralPromoterEF-1aAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2 blast
Plasmid#98293PurposeVariant of lentiCRISPRv2 that confers blasticidin S resistanceDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralPromoterEF-1aAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2 hygro
Plasmid#98291PurposeVariant of lentiCRISPRv2 that confers hygromycin resistanceDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralPromoterEF-1aAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2 puro
Plasmid#98290PurposeVariant of lentiCRISPRv2 that confers puromycin resistanceDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralPromoterEF-1aAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgCTL
Plasmid#234771PurposeNon Targeting ControlDepositorInsertNon Targeting Control sgRNA
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone1
Plasmid#162125PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone2
Plasmid#162126PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone3
Plasmid#162127PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgPnpt1-2#
Plasmid#234770Purposeknockout Pnpt1DepositorInsertPnpt1 (Pnpt1 )
UseLentiviralAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgPnpt1-1#
Plasmid#234769Purposeknockout Pnpt1DepositorInsertPnpt1 (Pnpt1 )
UseLentiviralAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgPlscr3-2#
Plasmid#234772Purposeknockout Plscr3DepositorInsertPlscr3 (Plscr3 Mouse)
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgPlscr3-1#
Plasmid#234767Purposeknockout Plscr3DepositorInsertPlscr3 (Plscr3 Mouse)
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCrls1-1#
Plasmid#234765Purposeknockout Crls1DepositorInsertCrls1 (Crls1 Mouse)
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCrls1-2#
Plasmid#234766Purposeknockout CrlsDepositorInsertCrls1 (Crls1 Mouse)
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 2
Plasmid#51761PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 2
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 1
Plasmid#51760PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 1
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone2
Plasmid#162129PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone1
Plasmid#162128PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 4
Plasmid#51763PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 4
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 5
Plasmid#51764PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 5
UseCRISPR and LentiviralPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 3
Plasmid#51762PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 3
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 6
Plasmid#51765PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 6
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone3
Plasmid#162130PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-dual-CRISPR-U6-H1(pBP43)
Plasmid#218930PurposeThe backbone lentiviral dual-CRISPR plasmid for making the dual-CRISPR screening libraries.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhuman U6 and H1Available SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha1 clone1
Plasmid#162119PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha1 clone2
Plasmid#162120PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only