We narrowed to 403 results for: amn
-
Plasmid#21922DepositorInsertMutant huamn HKII (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK2 Human)
UseTagsGFPExpressionMammalianMutationThis is the full length human HKII cDNA sequence …PromoterAvailable sinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pASPIre3
Plasmid#154844PurposeDerivative of pASPIre2 lacking mCherry but containing a silent 150 bp DNA spacer flanked by attB/P sites; main uASPIre plasmid used in this studyDepositorInsertBxb1-sfGFP fusion controlled by rhamnose-inducible promoter; attB/attP-flanked silent discriminator
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCK354
Plasmid#129698PurposeFor insulated expression in Synechocystis 6803. As pCK306 (rhaBAD rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites) + terminator ECK120010799DepositorInsertsPrhaBAD
yfp
rhaS
Terminator ECK120010799
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJUMP24_T24_pRham-ilvA-relE_RBS3_CB2
Plasmid#201533PurposeExpressing synthetic overlapping gene, ilvA-relE with internal RBS modification. Evolved strain with lower ilvA-relE expression. Origin pRO1600/ColE1 (E.coli - Pseudomonas shuttle)DepositorInsertilvA-relE_RBS3_CB2
UseSynthetic BiologyTagsExpressionMutationrhaR L128+1bp (frameshift), ilvA G455CPromoterPrhaBAD (rhamnose)Available sinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJUMP24_T24_pRham-ilvA-relE_RBS3_CB4
Plasmid#201535PurposeExpressing synthetic overlapping gene, ilvA-relE with internal RBS modification. Evolved strain with lower ilvA-relE expression. Origin pRO1600/ColE1 (E.coli - Pseudomonas shuttle)DepositorInsertilvA-relE_RBS3_CB4
UseSynthetic BiologyTagsExpressionMutationrhaS ΔM1-H5, PrhaSR Δ179bpPromoterPrhaBAD (rhamnose)Available sinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
TTR C10S S85C K80E
Plasmid#184744Purposebacterial expression of huamn TTR mutantsDepositorInsertTTR (TTR Human)
UseTagsExpressionBacterialMutationC10S, S85C, K80EPromoterT7Available sinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
RRRAA-5-mut-pHG165c
Plasmid#170113PurposeConstitutively expressed, mutationally-enhanced chimeric transcription activator comprising the AraC DNA binding domain and the RhaR rhamnose ligand binding domains.DepositorInsertRRRAA-5-MUT
UseTagsExpressionBacterialMutation5A14L, W116Q, E178K, S184T, S237LPromoterAvailable sinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK353
Plasmid#129697PurposeFor insulated expression in Synechocystis 6803. As pCK306 (rhaBAD rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites) + terminator ECK120015170DepositorInsertsPrhaBAD
yfp
rhaS
Terminator ECK120015170
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCK355
Plasmid#129699PurposeFor insulated expression in Synechocystis 6803. As pCK306 (rhaBAD rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites) + ilvBN terminatorDepositorInsertsPrhaBAD
yfp
rhaS
ilvBN terminator
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET30-GBF-E6
Plasmid#21696DepositorInsertprotein G domain B1 fused human papillomavirus type 16 amno acid residue 2-142 (E6 Human papillomavirus type 16)
UseTagsProtein G B1 domainExpressionBacterialMutationGB1 (1-56aa) fusion tag with mutations at three p…PromoterAvailable sinceJuly 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCryptDel4.8
Plasmid#141293PurposePlasmid for curing pMUT2 in one step based on pFREE. Contains RelB antitoxin, as well as gRNA targetting pMUT2 plasmid as well as pCryptDel4.8 itself.DepositorInsertsRelB
gRNA targetting pMUT2
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterNative promoter from pMUT2 relB/relE operon and P…Available sinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMis1_1B
Plasmid#192079PurposeA pBBR-1 based vector with IncP group plasmid compatibility for expression in Methylorubrum extorquens using rhamnose dependent inductionDepositorInsertsKanR
rhaR
rhaS
pBBR1 rep
UseTagsExpressionBacterialMutationPromoterAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
MuHKI-pGFPN3
Plasmid#21919DepositorInsertMutant huamn HKI (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK1 Human)
UseTagsGFPExpressionMammalianMutationThis is the full length human HKI cDNA sequence w…PromoterAvailable sinceNov. 2, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAH-CTX1-rhadCas9
Plasmid#129391PurposeDerived from pAH-CTX1-rha. The Burkholderia cenocepacia codon-optimized dCas9 cloned downstream of PrhaBAD. Hence, dCas9 is controlled by the rhamnose-inducible promoter system.DepositorInsertBurkholderia cenocepacia codon-optimized dCas9
UseCRISPRTagsExpressionBacterialMutationEntire dCas9 codon optimized for the GC-rich B. c…PromoterPrhaBADAvailable sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRCPam
Plasmid#195861PurposeEncodes chromogenic protein (CP) with nonsense mutation resulting in amber stop codon at amino acid 62. CP inducible with rhamnose in amber suppressor strains.DepositorInsertAmber Chromogenic Protein on pRCPam plasmid
UseTagsExpressionBacterialMutationGln62XPromoterAvailable sinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-C7TEQ6
Plasmid#103092PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertC7TEQ6(Cas9 coding gene from Lactobacillus rhamnosus (strain ATCC 53103 / GG))
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
prhaBAD-pA-Hia5
Plasmid#222303PurposePlasmid for rhamnose inducible expression and purification of protein A-Hia5-6XHis (pA-Hia5) for antibody directed DNA (adenine) methylation (as in DiMeLo-seq)DepositorInsertpA-Hia5
UseTags6His and protein AExpressionBacterialMutationcodon optimized for bacterial expressionPromoterrhaBADAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
prhaBAD-anti-mouse-Nb-Hia5
Plasmid#239626PurposeRhamnose inducible expression plasmid for anti-mouse nanobody fusion to Hia5 DNA adenine methyltransferaseDepositorInsertHia5
UseTags6HIS, MBP, TEV, and anti-Mouse NanobodyExpressionBacterialMutationCodon optimized for bacterial expressionPromoterrhaBADAvailable sinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only