We narrowed to 5,577 results for: dre
-
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationMutations to disrupt the uORFs and the stem-loop …Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-KChIP3 K+ channel [K66/38R-2b]
Plasmid#206628PurposeMammalian Expression Plasmid of anti-KChIP3 K+ channel (Rat). Derived from hybridoma K66/38-2b.DepositorInsertanti-KChIP3 K+ channel (Rattus norvegicus) recombinant Mouse monoclonal antibody (Kcnip3 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX305_FKBP12F36V-SHOC2
Plasmid#134522PurposeLentiviral plasmid expressing SHOC2 with N-term FKBP12(F36V) tagDepositorInsertSHOC2 (SHOC2 Human)
UseLentiviralTagsFKBP12F36V-2xHAExpressionMammalianMutationSilent mutations made at wobble base position at …PromoterhPGKAvailable SinceNov. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pF1-Hs Cdk1/cyclin B1/Cks1
Plasmid#177329PurposeCo-expression of the human active Cdk1/cyclin B1/Cks1 kinase complexDepositorInsertsTags2 x Strep-tag and 8 x HisExpressionInsectPromoterp10 and polhAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-KChIP3 K+ channel [K66/38R-rat IgG2a] - Chimeric
Plasmid#231831PurposeMammalian expression plasmid of anti-KChIP3 K+ channel (Rat) rat IgG2a R-mab. Derived from hybridoma K66/38.DepositorInsertAnti-KChIP3 K+ channel (Rattus norvegicus) recombinant mouse monoclonal antibody (Kcnip3 Chimera: M. musculus (mouse)/R. norvegicus (rat))
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterDual CMVAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiCHATe27_Gq_dTomato
Plasmid#213832PurposeAAV construct expressing HA-hM3Dq-dTomato driven by cholinergic neuron-targeting enhancer. Alias: pAAV_S9E27_Gq_dTomatoDepositorInsertHA-GqDREADD-dTomato
UseAAVAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe4_Gq_dTomato
Plasmid#213946PurposeAAV construct expressing HA-hM3Dq-dTomato driven by SST interneuron-targeting enhancer. Alias: pAAV_WDS0004_Gq_dTomatoDepositorInsertHA-GqDREADD-dTomato
UseAAVAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiVIPe4_Gq_dTomato
Plasmid#213858PurposeAAV construct expressing HA-hM3Dq-dTomato driven by VIP interneuron-targeting enhancer. Alias: pAAV_YWE4.2_Gq_dTomatoDepositorInsertHA-GqDREADD-dTomato
UseAAVAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe4_Gq_dTomato
Plasmid#213938PurposeAAV construct expressing HA-hM3Dq-dTomato driven by chandelier cell-targeting enhancer. Alias: pAAV_WDC0004_Gq_dTomatoDepositorInsertHA-GqDREADD-dTomato
UseAAVAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe3_Gq_dTomato
Plasmid#213942PurposeAAV construct expressing HA-hM3Dq-dTomato driven by PV+ basket cell-targeting enhancer. Alias: pAAV_WDP0003_Gq_dTomatoDepositorInsertHA-GqDREADD-dTomato
UseAAVAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe10_Gq_dTomato
Plasmid#213817PurposeAAV construct expressing HA-hM3Dq-dTomato driven by SST interneuron-targeting enhancer. Alias: pAAV_S9E10_Gq_dTomatoDepositorInsertHA-GqDREADD-dTomato
UseAAVAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_Gq_dTomato
Plasmid#213916PurposeAAV construct expressing HA-hM3Dq-dTomato driven by Lamp5 interneuron-targeting enhancer. Alias: pAAV_WDL0003_Gq_dTomatoDepositorInsertHA-GqDREADD-dTomato
UseAAVAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
His-ZZ-TEV-SNAPf DHC1_IC2C_LIC2_Tctex1_Robl1_LC8
Plasmid#111903PurposeFull length human cytoplasmic dynein 1 complex, optimised for Sf9 expression. 8xHis-ZZ tag followed by TEV cleavage site and SNAPf tag on the N-terminus of dynein heavy chain 1.DepositorInsertsTags8xHis, SNAPf-tag, TEV site, and ZZ-tagExpressionInsectMutationOptimised for expression in Sf9 cells.Available SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Dynein-2_complex
Plasmid#132536PurposeFull length human (Hs) IFT dynein (dynein-2) complex for Sf9 expression. Contains His-ZZ-TEV-SNAPf-HC, WDR60, WDR34-Strep, LIC3, TCTEX-1, TCTEX1D2, LC8-1, LC8-2, TCTEX-3, Rbl-1, Rbl-2, LC8-like.DepositorInsertsTags8x His, Linker-TEV-linker-TEV, SNAPf, Strep, and …ExpressionInsectMutationCodon optimised for Sf9 expressionAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only