We narrowed to 7,844 results for: amph
-
Plasmid#53087PurposeProduces the carotenoid violaxanthin in E. coli.DepositorInsertzep (ABA1 Mustard Weed)
UseLow copy number bacterial cloning vectorTagsExpressionMutationLacks codons for the first 60 N-terminal amino ac…PromoterT7Available sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-ccdB-boxB-tBE-V5-mA3
Plasmid#171693PurposeExpresses tBE-V5-mA3 in mammalian cellsDepositorInsertccdB-sgRNA scaffold-boxB-tBE-V5-mA3
UseCRISPRTagsExpressionMammalianMutationPromoterU6 and EF1aAvailable sinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBFC0984
Plasmid#231992PurposeCRISPRi-ART plasmid encoding aTc-inducible dRfxCas13d and constitutive crRNA with 2xBsaI spacer cloning siteDepositorInsertsdRfxCas13d
crRNA with 2xBsaI spacer
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterJ23119 and pTetAvailable sinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWZL-Neo-Myr-Flag-DEST
Plasmid#15300Purposea Gateway-compatible retroviral destination vector which adds a myristoylation sequence and a FLAG tag to each introduced ORFDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRetroviralTagsFlag and MyrExpressionMammalianMutationPromoterAvailable sinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBFC0993
Plasmid#231993PurposeCRISPRi-ART plasmid encoding aTc-inducible dRfxCas13d and constitutive crRNA with negative control (RFP-targeting) spacerDepositorInsertsdRfxCas13d
crRNA with negative control (RFP-targeting) spacer
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterJ23119 and pTetAvailable sinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-AREG-ScNeo
Plasmid#209897PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertAREG-ScNeo (AREG Human)
UseLentiviralTagsmNeonGreen and mScarletExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSExpressionMutationPromoterp40S (AN0465) Aspergillus nidulansAvailable sinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-N1
Plasmid#125547PurposeGateway compatible N2H assay destination vector with N-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to n-terminus of Gatew…ExpressionBacterial and MammalianMutationPromotersynthetic promoter containing yeast, mammalian, a…Available sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C1
Plasmid#125549PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to c-terminus of Gatew…ExpressionMammalian and YeastMutationPromotersynthetic promoter containing yeast, mammalian, a…Available sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C2
Plasmid#125559PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to c-terminus of Gatew…ExpressionMammalian and YeastMutationPromotersynthetic promoter containing yeast, mammalian, a…Available sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-N2
Plasmid#125548PurposeGateway compatible N2H assay destination vector with N-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to n-terminus of Gatew…ExpressionMammalian and YeastMutationPromotersynthetic promoter containing yeast, mammalian, a…Available sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pThermoCas9i_ctrl
Plasmid#100982PurposeExpresses the catalytically inactive version of ThermoCas9 (Thermo(d)Cas9) and its sgRNA moduleDepositorInsertsCatalytically inactive variant of the Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
UseTagsNoneExpressionBacterialMutationchanged aspartate 8 to alanine and histidine 582 …PromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available sinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-G6
Plasmid#73437PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant G6.DepositorInsertRepressor G6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB-6HIS-TEV-mEGFP,IRES-NGFR
Plasmid#164521PurposeAll-in-One piggyBac transposon Gateway Destination vector for dox-inducible expression of N-terminal His-TEV-GFP tagged protein (inducible NGFR and constitutive rtTA and neomycin resistance)DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-C4
Plasmid#73427PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
UseTagsExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only