We narrowed to 2,925 results for: GFP reporter gene
-
Plasmid#127611PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T305D/T306D)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 305/306 to AlaninePromoterpCAGAvailable SinceJan. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pY71-PT7-RiboJ-sfGFP-MGapt
Plasmid#129119PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.DepositorInsertSuperfolder GFP with Malachite Green aptamer
UseSynthetic BiologyTagsHis6 and RiboJ InsulatorExpressionBacterialPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-LC3B G120A
Plasmid#123115PurposeExpresses EGFP-LC3B G120A in mammalian cells. Negative control fluorescent reporter, unable to localize to autophagosomes.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFPExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
EW408 (ZNF35tar-compact)x8-H2B-GFP
Plasmid#236129PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with eight ZNF35 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with eight ZNF35 binding sit…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
p406 – TDH3-ER-FlucDM-GFP11-Ura
Plasmid#177731PurposeDM Firefly luciferase reporter fused to a KAR2 signal sequence for ER targeting and HDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminus in yeast plasmid withDepositorInsertFlucDM
TagsGFP11, HA, HDEL, and KAR2 Signal SequenceExpressionBacterial and YeastMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p406 – TDH3-ER-FlucDM-GFP- Ura
Plasmid#177732PurposeDM Firefly luciferase reporter fused to a KAR2 signal sequence for ER targeting and HDEL for ER retention and fused to eGFP at the C-terminus in yeast plasmid with URA markerDepositorInsertFlucDM
TagsHA, HDEL, KAR2 Signal Sequence, and eGFPExpressionBacterial and YeastMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSJ1321 (pRS315-NOP1pr-GFP11-mCherry-PUS1)
Plasmid#86413Purposenuclear split GFP11 reporter with mCherryDepositorInsertNop1pr-GFP11-mCherry-PUS1
TagsGFP11 and mCherryExpressionYeastPromoterNOP1Available SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSJ1568 (pRS315-NOP1pr-GFP11-mCherry-SCS2TM)
Plasmid#86416PurposeONM/ER split GFP11 reporter with mCherryDepositorInsertNOP1pr-GFP11-mCherry-Scs2TM
TagsGFP11 and mCherryExpressionYeastPromoterNOP1Available SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-zic2a Q
Plasmid#89386PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertzic2a (zic2a Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSJ1602 (pRS315-NOP1pr-mCherry-SCS2TM-GFP11)
Plasmid#86417Purposeluminal split GFP11 reporter with mCherryDepositorInsertNOP1pr-mCherry-SCS2TM-GFP11
TagsGFP11 and mCherryExpressionYeastPromoterNOP1Available SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-zic2a P
Plasmid#89385PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertzic2a (zic2a Zebrafish)
Available SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-zic2a S
Plasmid#89388PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertzic2a (zic2a Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 R0+R1+R3 +SV40 base prom-GFP-IRES-AP
Plasmid#225892PurposeEnhancer reporterDepositorInsertR0+R1+R3
TagsEGFPExpressionMammalianAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway mmu SE-Zic2 U
Plasmid#89390PurposeVector for reporter assay of one mouse super-enhancer regionDepositorInsertZic2 (Zic2 Mouse)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway mmu SE-Zic2 T
Plasmid#89389PurposeVector for reporter assay of one mouse super-enhancer regionDepositorInsertZic2 (Zic2 Mouse)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-zic2a R
Plasmid#89387PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertzic2a (zic2a Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-zic2a M
Plasmid#89382PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertzic2a (zic2a Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-zic2a L
Plasmid#89381PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertzic2a (zic2a Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-zic2a O
Plasmid#89384PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertzic2a (zic2a Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-zic2a N
Plasmid#89383PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertzic2a (zic2a Zebrafish)
Available SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.mArid3a3xFLAG.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
Plasmid#174666PurposeDoxycycline-inducible expression of murine Arid3a-3xFLAG cDNA with dTomato as reporter fluorescent proteinDepositorAvailable SinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.ARID3a.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
Plasmid#169314PurposeDoxycycline-inducible expression of human ARID3A cDNA with dTomato as reporter fluorescent proteinDepositorAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.mArid3a.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
Plasmid#169318PurposeDoxycycline-inducible expression of murine Arid3a cDNA with dTomato as reporter fluorescent proteinDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.dTomato.miR-125b-2.PGK.sfGFP.P2A.Tet3G
Plasmid#169315PurposeDoxycycline-inducible expression of miR-125b-2 with dTomato as reporter fluorescent proteinDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2705-AGER-eGFP
Plasmid#216474Purposedonor vector for targeting an eGFP reporter to the human AGER locus at the endogenous ATG start siteDepositorInserteGFP
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-membrane-mEGFP
Plasmid#105526PurposeT7 promotor drives in vitro mRNA transcription of a mEGFP-tagged membrane reporterDepositorInsertGNAI2 (GNAI2 Human)
UseIn vitro transcriptionTagsmEGFPMutationfragment encoding the plasma membrane targeting s…PromoterT7Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-mCherry-DMDEx23-eGFP
Plasmid#211366PurposePiggybac transposon plasmid for a DMD exon 23 skipping reporter (mCherry-DMDEx23)DepositorInsertmCherry-DMDEx23-eGFP
ExpressionMammalianMutationmCherry interrupted by mdx dystrophin exon 23 bet…PromoterCAGAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSEM387 - mosTI unc-119 - NNN - gfp - nls - tbb-2
Plasmid#182347PurposeGFP transcriptional reporter cloning vector for mosTI(unc-119). Transgene inserted upstream of gfp(2xNLS) and tbb-2 3' UTR. MCS or Golden Gate (BsaI: tgcc - MCS - aaaa)DepositorTypeEmpty backboneExpressionWormAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR0-37a +SV40 base prom-GFP-IRES-AP
Plasmid#225889PurposeEnhancer reporterDepositorInsertmR0-37a
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only