We narrowed to 24,695 results for: Sis
-
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pR26 CAG AsiSI/MluI
Plasmid#74286PurposeGene targeting vector for the mouse Rosa26 locus, including a CAG promoter and loxP flanked stop cassette, for cloning into AsiSI or MluiDepositorInsertRosa26 5-homology region
Available SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant mNG-ORP8
Plasmid#195170Purposemammalian expression of siRNA-resistant ORP8 tagged with mNeonGreenDepositorInsertORP8 (OSBPL8 Human)
TagsmNeonGreenExpressionMammalianMutationWobble mutations for siRNA resistance from K174 t…PromoterCMVAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-PPP2R5E siRNA-resistant
Plasmid#120861Purposeexpresses dox-inducible PPP2R5E resistant to siRNA pool 2 used in manuscriptDepositorInsertPPP2R5E (PPP2R5E Human)
TagsFLAGExpressionMammalianMutationsilent mutation at aa 282-284 in PPP2RE to genera…Available SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLYS1-EMRE/RNAi resistant
Plasmid#50056PurposeExpression of human EMRE in mammalian cells with silent mutation making it resistant to RNAiDepositorInsertEMRE-RNAi resistant (SMDT1 Human)
ExpressionMammalianMutationRNAi resistant, silent mutantAvailable SinceFeb. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/GFP-SCAF8 (CRISPR_resistant)
Plasmid#122472PurposeDox-inducible GFP (N-terminal tag) SCAF8 expressionDepositorInsertSCAF8 (SCAF8 Human)
TagsGFPExpressionMammalianMutationSynonymous mutations conferring resistance to gRN…PromoterCMVAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant SigmaR1-mCherry
Plasmid#226567PurposeEncodes siRNA resistant SigmaR1 protein labeled with mCherryDepositorAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-sh5Resistant
Plasmid#225448PurposeExpress mEGFP-fusion protein of FXR1 isoform a with shRNA5-resistant silent mutationDepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
6975 pPROEX-HTb-SIS1
Plasmid#1233DepositorAvailable SinceJuly 18, 2005AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant ABHD16A-Halo
Plasmid#195163Purposemammalian expression of siRNA-resistant ABHD16A tagged with Halo tagDepositorInsertABHD16A (ABHD16A Human)
TagsHalo tagExpressionMammalianMutationWobble mutations for siRNA resistance from L90 to…PromoterCMVAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only