We narrowed to 5,920 results for: pAAV
-
Plasmid#189751PurposeExcludes sensor expression in Cre-positive neuronsDepositorInsertDopamine sensor GRAB_DA2m
UseAAVPromoterEF1aAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-proCaspase-3-TEVp
Plasmid#166607PurposeEncodes Cre-dependent procaspase 3 and TEVp under control of the TREDepositorInsertprocaspase3- TEVp
UseAAVPromotertetracycline response elementAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP303-pAAV-CMV-dSaCas9-VP64-pA
Plasmid#113678PurposeA CMV driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/5'USS-GFP
Plasmid#197884PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre and the leakage expression is reduced without CreDepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iRFP682-P2A-GFP
Plasmid#197153PurposeExpresses the protein of iRFP682-P2A-GFP in mammalian cellsDepositorInsertiRFP682-P2A-GFP
UseAAVAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-TagRFP658-P2A-GFP
Plasmid#178971PurposeExpresses TagRFP658 and GFP in mammalian cellsDepositorInsertTagRFP658-P2A-GFP
UseAAVExpressionMammalianPromoterCAGAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKIIa-moxBFP-IRES-Flpo
Plasmid#194977PurposeAAV vector to drive expression of moxBFP and Flpo under the control of CamKIIalpha promoterDepositorInsertmoxBFP, Flpo
UseAAVAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-flex-GFP-shRNA-scramble
Plasmid#182503PurposeExpresses scramble shRNA for control expts. Flexed cassette driven by pan neuronal gene promoterDepositorInsertpan neuronal promoter driving flexed GFP-shRNA scramble from mir 30 cassette
UseAAV, Cre/Lox, and RNAiExpressionMammalianPromoterhSyn promoterAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DO-ChETA-TdTomato-WPRE-pA
Plasmid#37756PurposeExpresses ChETA-TdTomato in cells lacking Cre (Cre-Off), for optogenetic excitationDepositorInsertChETA-TdTomato
UseAAV and Cre/Lox; Cre-offTagsTdTomatoPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Htr5b(3.7)-EGFP-sv40
Plasmid#184411PurposeAAV expression of EGFP from mouse 5-hydroxytryptamine (serotonin) receptor 5B (Htr5b) gene promoter.DepositorInsertMouse Htr5b gene promoter-EGFP (Htr5b Mouse)
UseAAVTagsEGFPExpressionMammalianPromoterMouse Htr5b geneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-oScarlet
Plasmid#137138PurposeIntersectional viral expression of oScarlet in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE95DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn_NES-His-rsCaMPARI-mRuby3
Plasmid#120805PurposeAAV plasmid for expressing rsCaMPARI in neurons, nucleus excludedDepositorInsertrsCaMPARI
UseAAVTagsNES-His and mRuby3Promoterhsyn (synapsin-1)Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-(STChRger2-TS-EYFP)
Plasmid#129394PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Uses the CAG promoter and double floxed.DepositorInsertsoma targeted ChRger2
UseAAV and Cre/LoxTagsKv2.1-TS-EYFPExpressionMammalianPromoterCAGAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-TVA66T-EGFP
Plasmid#64091PurposeExpresses TVA66T-EGFP under the CAG promotorDepositorInsertTVA66T-EGFP
UseAAV and Cre/LoxTagsEGFPExpressionMammalianMutationGlutamic acid 66 to ThreoninePromoterCAGAvailable SinceApril 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.SV40.THBS1-deltaTSR1-HA.SV40(polyA)
Plasmid#156162PurposeExpresses murine Thrombospondin-1 (THBS1) with deletion (AA 383-548) and HA-tag at C-terminusDepositorInsertThrombospondin-1 (Thbs1 Mouse)
UseAAVTagsHA-tagExpressionMammalianMutationTHBS1 with deletion of amino acid residues 383-548PromoterCMVAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
206_pAAV-ProD17-CatCh-GFP-WPRE
Plasmid#125993PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD17Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eGFP-L10a
Plasmid#166605PurposeEncodes Cre-dependent eGFP-L10a under control of the TREDepositorInserteGFP-L10a
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
III_pAAV-ProB4-CatCh-GFP-WPRE
Plasmid#125924PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB4Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
70_pAAV-ProA23-CatCh-GFP-WPRE
Plasmid#125906PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA23Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
(326) pAAV SV40-ZsGreen U6-gRNA
Plasmid#163020PurposeFluorescent reporter for Sa gRNA (Bsa1 sites)DepositorInsertZs Green
UseAAVExpressionMammalianPromoterSV40Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-rsChRmine-eYFP-WPRE
Plasmid#183531PurposeOptogeneticsDepositorInsertrsChRmine-eYFP
UseAAVMutationI146M/G174SPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
151_pAAV-ProC29-CatCh-GFP-WPRE
Plasmid#125964PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC29Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-EcYtR(NGS-6)-mCherry
Plasmid#217363PurposeExpresses E. coli tyrosine tRNA variant "NGS-6" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli tyrosine tRNA mutant, "NGS-6"
UseAAVExpressionMammalianPromoterU6Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DO-ChETA-EYFP-WPRE-pA
Plasmid#37086PurposeExpresses ChETA-EYFP in cells lacking Cre (Cre-Off), for optogenetic excitationDepositorInsertChETA-YFP
UseAAV and Cre/Lox; Cre-offTagsEYFPPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-SnFR-gamma8-minWPRE
Plasmid#165498PurposeAAV for glutamate reporter fused to TARP gamma-8DepositorInsertiGluSnFR extracellular domain fused to TARP gamma-8 via NETO2 TM domain (Cacng8 Synthetic, Rat)
UseAAVPromoterhSynapsinAvailable SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-hSyn1-NES-ChemoG-CaM
Plasmid#193817PurposeExpression of ChemoG-CaM in primary neuronsDepositorInsertChemoG-CaM
UseAAVMutationEGFP:A206K; HT7: L271EPromoterhSyn1Available SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-mDLX-TVA-2A-N2cG
Plasmid#172365PurposeTargeting envA-pseodotyped RVdG-CVS-N2c vectors for specific retrograde labeling from cre-expressing inhibitory neuronsDepositorInsertTVA + B19-N2cG
UseAAV and Cre/LoxExpressionMammalianPromotermDLXAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
17_pAAV-ProB1-CatCh-GFP-WPRE
Plasmid#125921PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB1Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FRT-JEDI-1P-Kv-WPRE
Plasmid#202617PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P flanked by FRT in AAV production vector expressed under the mammalian promoter (EF1a), FLP recombinase-dependentDepositorInsertFRT-JEDI-1P-Kv
UseAAV; Flp/frtExpressionMammalianPromoterEF1aAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-GRAB_r5-HT1.0
Plasmid#208725PurposeExpresses the red 5-HT sensor GRAB_r5-HT1.0 in neurons in the presence of Cre recombinaseDepositorInsertRed fluorescent 5-HT sensor GRAB_r5-HT1.0
UseAAVPromoterEF1aAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
107_pAAV-ProC17-CatCh-GFP-WPRE
Plasmid#125952PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC17Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mNeptune2.5-P2A-GFP
Plasmid#197156PurposeExpresses the protein of mNeptune2.5-P2A-GFP in mammalian cellsDepositorInsertmNeptune2.5-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-fd [Chronos-GFP]
Plasmid#84482PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/forward (Cre-dependent) manner. Cre turns gene off. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.1)-CMV-eGFP
Plasmid#194015PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.1)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMV and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-Mac-GFP
Plasmid#58852PurposeAAV-mediated expression of Mac-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) mannerDepositorInsertMac-GFP
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-ConVERGD-eGFP-WPRE
Plasmid#218747PurposeProvides AND intersectional (Cre+Flp) expression of eGFPDepositorInserteGFP
UseAAVPromoternEFAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-ConVERGD-eGFP-W3SL
Plasmid#218746PurposeProvides AND intersectional (Cre+Flp) expression of eGFPDepositorInserteGFP
UseAAVPromoternEFAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC533 - pAAV SYN1 eGFP-2A-mKv1.2
Plasmid#75295PurposeAn AAV packaging vector that expresses eGFP and Kv1.2 under the control of a neuronal promoter.DepositorAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
HT115_pAAV_hSyn-DiO-SomQuasAr6b_EGFP-P2A-somCheRiff_HA
Plasmid#178827PurposeCre-on bicistronic expression of QuasAr6b-based Optopatch under an neuronal promoterDepositorInsertSomQuasAr6a_EGFP-P2A-somCheRiff_HA
UseAAV, Cre/Lox, and Mouse TargetingTagsEGFP, HAExpressionMammalianPromoterhSynAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-NOS-IN133.3xFLAG.mCherry-WPRE
Plasmid#127868PurposepAAV plasmid expressing an NOS-IN133.3xFLAG.mCherry fusion protein under the hSyn promoterDepositorInsertNos1 (Nos1 Mouse)
UseAAVTags3xFLAG and mCherryMutationAmino acids 1-133 onlyPromoterhSynAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ND4 Right-GSVG-UGI
Plasmid#187414Purposehuman mitochondrial DNA ND4 target TALEDepositorInsertDddA GSVG variant
UseAAV and TALENExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ND4 Right-E1347A-UGI
Plasmid#187415Purposehuman mitochondrial DNA ND4 target TALEDepositorInsertDddA GSVG variant
UseAAV and TALENExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA TdL
Plasmid#80938PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdL for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.SV40.THBS1-deltaCTD-HA.SV40(polyA)
Plasmid#156163PurposeExpresses truncated (AA 1-954) murine Thrombospondin-1 (THBS1) protein with HA-tag at C-terminusDepositorInsertThrombospondin-1 (Thbs1 Mouse)
UseAAVTagsHA-tagExpressionMammalianMutationTruncated THBS1 (amino acid residues 1-954)PromoterCMVAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-GRAB_g5-HT3.0mut
Plasmid#208724PurposeExpresses the green 5-HT sensor GRAB_g5-HT3.0mut in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT3.0mut
UseAAVPromoterEF1aAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miRFP720-P2A-GFP
Plasmid#197165PurposeExpresses the protein of miRFP720-P2A-GFP in mammalian cellsDepositorInsertmiRFP720-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SNIFP-P2A-GFP
Plasmid#197157PurposeExpresses the protein of SNIFP-P2A-GFP in mammalian cellsDepositorInsertSNIFP-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {ChETA}on-WPRE
Plasmid#111386PurposeAAV expression of ChETA (hChR2 with E123T/H134R mutations) fused to HA tag driven by hSynapsin promoter in Cre-ON manner for optogenetic activationDepositorInsertChETA
UseAAVTagsHAExpressionMammalianMutationhumanized ChR2, E123T/H134RPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn intron Psam4GlyR m3m4 HA
Plasmid#196041PurposeAAV for Chemogenetic plasmidsDepositorInsertPsam4GlyR m3m4 HA
UseAAVTagsHAExpressionMammalianPromoterSynapsinAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only