We narrowed to 5,920 results for: pAAV
-
Plasmid#202620PurposeDouble floxed red fluorescent protein mCherry in AAV production vector expressed under the mammalian promoter (EF1a)DepositorInsertmCherry
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP307-pAAV-EFS(No AgeI)-MCS3-pA
Plasmid#113684PurposeEFS driven Multi Cloning Site-3 without the AgeI restriction enzyme site.DepositorInsertN/A
UseAAVPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP-S-WPRE
Plasmid#127867PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP-S fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Human, Mouse)
UseAAVTags3xFLAG and mCherryMutationconstructed by blunt end fusion of the 5’ 51 nucl…PromoterhSynAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDC-DIO-GFP-shRNA.scramble
Plasmid#184331PurposeExpresses scramble shRNA for control expts. Flexed (DIO) cassette driven by hdc promoter fragment for pan neuronal expressionDepositorInserthdc pan neuronal gene promoter, flex switch, GFP, scramble shRNA
UseAAV, Cre/Lox, Mouse Targeting, and RNAiExpressionMammalianPromoterhistidine decarboxylase promoter fragment that g…Available SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miniSOG-T2A-dTomato
Plasmid#193796PurposeExpresses miniSOG in the cytosol of mammalian cells, joined by a T2A cleavage site with dTomatoDepositorInsertminiSOG
UseAAVTagsFlag tagExpressionMammalianPromoterCAGAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AP.Adamts2.1-DIO-GCaMP8s-WPRE
Plasmid#211491Purposeconditional expression of GCaMP8s under artificial promoter Adamts2DepositorInsertDIO-GCaMP8s
UseAAVExpressionMammalianAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AP.Baz1a.1-DIO-GCaMP8s-WPRE
Plasmid#211493Purposeconditional expression of GCaMP8s under artificial promoter Baz1aDepositorInsertDIO-GCaMP8s
UseAAVExpressionMammalianAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
119_pAAV-ProC25-CatCh-GFP-WPRE
Plasmid#125960PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC25Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [ChrimsonR-GFP]
Plasmid#108273PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1α promoter (1.1kb short version)Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-GRAB_g5-HT2m
Plasmid#208722PurposeExpresses the green 5-HT sensor GRAB_g5-HT2m in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT2m
UseAAVPromoterEF1aAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
62_pAAV-ProA19-CatCh-GFP-WPRE
Plasmid#125902PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA19Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
60_pAAV-ProA17-CatCh-GFP-WPRE
Plasmid#125900PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA17Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
3_pAAV-ProA8-CatCh-GFP-WPRE
Plasmid#125892PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA8Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nef-CIAO-TVA-mCherry
Plasmid#149295PurposeCre-dependent expression of TVA:mCherry fusion protein for rabies tracing.DepositorInsertTVA:mCherry
UseAAVMutationStart codon removed.Available SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
IX_pAAV-ProB3-CatCh-GFP-WPRE
Plasmid#125923PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGFP
UseAAVPromoterProB3Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hsChRmine-eYFP-WPRE
Plasmid#183530PurposeOptogeneticsDepositorInserthsChRmine-eYFP
UseAAVMutationH33RPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
114_pAAV-ProC22-CatCh-GFP-WPRE
Plasmid#125957PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC22Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CCre-MBP4-WPRE
Plasmid#193919PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertCCre-MBP4
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCre-MBP5-WPRE
Plasmid#193918PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertNCre-MBP5
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1APΔC20-WPRE
Plasmid#127865PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1APΔC20 fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse)
UseAAVTags3xFLAG and mCherryMutationdeleted the c-terminal 20 amino acidsPromoterhSynAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
p164-pAAV-mDlx-FLEX-mScarlet
Plasmid#204689PurposeFluorescent reporter under the control of the Dlx promotorDepositorInsertmScarlet
UseAAV and Cre/LoxTagsmScarlet palmitoylationExpressionMammalianPromotermDlxAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Chronos-GFP]
Plasmid#84485PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α, 1.1 kb long (short version)Available SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mIFP-P2A-GFP
Plasmid#197168PurposeExpresses the protein of mIFP-P2A-GFP in mammalian cellsDepositorInsertmIFP-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-Rev-FlpO
Plasmid#191209PurposeCre dependent FlpO expression under the control of CAG promoterDepositorInsertFlpO
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Susd4(3.7)-EGFP-sv40
Plasmid#184413PurposeAAV expression of tTA from mouse sushi domain containing 4 (Susd4) gene promoter.DepositorInsertMouse Susd4 gene promoter-EGFP (Susd4 Mouse)
UseAAVTagsEGFPExpressionMammalianPromoterMouse Susd4 geneAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
35_pAAV-ProC8-CatCh-GFP-WPRE
Plasmid#125943PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC8Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
140_pAAV-ProA33-CatCh-GFP-WPRE
Plasmid#125916PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA33Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
167_pAAV-ProC34-CatCh-GFP-WPRE
Plasmid#125968PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC34Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
13_pAAV-ProC71-CatCh-GFP-WPRE
Plasmid#125976PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC71Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FRT-EBFP-tTAn
Plasmid#172127PurposeExpression of EBFP and tTA-InteinN in Flp recombinase positive cellsDepositorInsertEBFP, tTAn-InteinN
UseAAVPromoterEF1aAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapsin.mCherry-P2A-Post-SPHERE-SF-iGluSnFR
Plasmid#187102PurposeGlutamate sensor for localization to membrane contatctDepositorArticleInsertPost-SPHERE-SF-iGluSnFR
UseAAVTagsmCherry-P2AExpressionMammalianPromoterhSynAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapsin.TagBFP-P2A-Pre-SPHERE-SF-iGluSnFR
Plasmid#187101PurposeGlutamate sensor for localization to membrane contatctDepositorArticleInsertPre-SPHERE-SF-iGluSnFR
UseAAVTagsTagBFP-P2AExpressionMammalianPromoterhSynAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1APC20-WPRE
Plasmid#127866PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1APC20 fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse)
UseAAVTags3xFLAG and mCherryMutationC-terminal 20 amino acids onlyPromoterhSynAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
153_pAAV-ProC31-CatCh-GFP-WPRE
Plasmid#125966PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC31Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-sbGLuc-CheRiff-EGFP
Plasmid#114108Purposefusion protein of Gaussia luciferase variant slow burn, synthetic channelrhodopsin CheRiff, and enhanced green fluorescent protein for bioluminescent optogeneticsDepositorInsertGaussia luciferase, slow burn; CheRiff synthetic ChR; EGFP
UseAAVExpressionMammalianPromoterhSynAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
37_pAAV-ProC40-CatCh-GFP-WPRE
Plasmid#125974PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC40Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
88_pAAV-ProA5-CatCh-GFP-WPRE
Plasmid#125889PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA5Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.SV40.THBS1-deltaCC-HA.SV40(polyA)
Plasmid#155195PurposeExpresses murine Thrombospondin-1 (THBS1) protein with deletion of Coiled Coil domain and HA-tag at C-terminusDepositorInsertThrombospondin-1 (Thbs1 Mouse)
UseAAVTagsHA-tagExpressionMammalianMutationTHBS1 with deletion of amino acid residues 276-315PromoterCMVAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-Rev-TdTomato
Plasmid#122501PurposeCre-dependent TdTomato expression.DepositorInsertTdTomato
UseAAVPromoterCAGAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn_NLS-His-rsCaMPARI-mRuby3
Plasmid#122092PurposeAAV plasmid for expressing rsCaMPARI in neurons, nucleus localizedDepositorInsertrsCaMPARI
UseAAVTagsNLS-His and mRuby3Promoterhsyn (synapsin-1)Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-splitTVA-EGFP
Plasmid#59332PurposeExpresses splitTVA-P2A-EGFPDepositorInsertsplitTVA950-P2A-EGFP
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterCAGAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Kir2.1Mut-2A-mScarlet-KASH
Plasmid#203841Purposenon-functional Kir2.1(mutant) expression as a control for the silencing of neurons with Kir2.1 and mScarlet-KASH expressionDepositorHas ServiceAAV2InsertKir2.1 (Kcnj2 Mouse)
UseAAVTags2A-mScarlet-KASHMutationG144A, Y145A, G146AAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1617 pAAV SYN1 Nuc-EYFP
Plasmid#135567PurposeAn AAV vector expressing a neuronally expressed nuclear EYFP reporterDepositorInsertsempty
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianPromoterhSYN1Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex-Turbo/GFP
Plasmid#197886PurposeCan be used to generate AAV virus that will express Turbo/GFP in the presence of CreDepositorInsertTurbo/GFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgNtsr1
Plasmid#159910PurposeMutagenesis of Ntsr1DepositorInsertNtsr1 (Ntsr1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
78_pAAV-ProA27-CatCh-GFP-WPRE
Plasmid#125910PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA27Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV syn CCL20-pre-mGRASP
Plasmid#173117PurposeExpresses CCL20 sender construct in neuronsDepositorInsertCCL20-pre-mGRASP
UseAAVPromoterSynapsinAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only