We narrowed to 5,920 results for: pAAV
-
Plasmid#231361PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from the minBG promoter with mscRE4 enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CMVe-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231354PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter and CMV enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-NLS-EGFP-WPRE-SV40pA-T7-T3-BC(p1-14)
Plasmid#231345PurposeSingle stranded AAV genome with components for tracking AAV genome via AAV-Zombie. Also expresses a nuclear localized EGFP from CAG promoter.DepositorInsertT7/T3-BC(p1-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4s-PDGFR-WPRE
Plasmid#234449PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DjCas13d-P2A-mCherry-pA
Plasmid#233027PurposeTo Express HA tagged DjCas13d and mcherry from the mammalian EFS promoter. The DjCas13dx and mCherry are separated by a P2A siteDepositorInsertDjCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-P2A-mCherry-pA
Plasmid#233026PurposeTo Express HA Tagged hfCas13d and mcherry from the mammalian EFS promoter. The hfCas13d and mCherry are separated by a P2A siteDepositorInserthfCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1343 - pAAV-AiE2051m-minBG-iCre
Plasmid#220705PurposeAiE2051m is an enhancer sequence, designed to induce cre-dependent recombination in specific populations of brain cellsDepositorInsertiCre
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1344 - pAAV-AiE2052m-minBG-iCre
Plasmid#220706PurposeAiE2052m is an enhancer sequence, designed to induce cre-dependent recombination in specific populations of brain cellsDepositorInsertiCre
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1345 - pAAV-AiE2057m-minBG-iCre
Plasmid#220707PurposeAiE2057m is an enhancer sequence, designed to induce cre-dependent recombination in specific populations of brain cellsDepositorInsertiCre
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC130: pAAV.CMV-CasRx-VEGFA sgRNA
Plasmid#203443PurposePlasmid expressing active RfxCas13d with VEGFA mRNA targeting gRNADepositorInsertsU6-VEGFA sgRNA
RfxCas13d
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM149: pAAV.CMV-Cas13e-VEGFA sgRNA
Plasmid#203447PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNADepositorInsertsU6-VEGFA sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC368: pAAV.CMV-Cas13e-VEGFA sgRNA2
Plasmid#227800PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA2DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC369: pAAV.CMV-Cas13e-VEGFA sgRNA3
Plasmid#227801PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA3DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-DiO-eGFP-2A-mCherry_YDA
Plasmid#194881PurposeRatiometric YDA sensor for in vivo cre-dependent neuron-specific cholesterol visualizationDepositorInsertGFP-T2A-mCherry-YDA
UseAAV and Cre/LoxExpressionMammalianPromoterhuman SynapsinAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgPet-1-hSyn-mCherry-KASH
Plasmid#223227PurposeguideRNA targeting the mouse Pet-1 (Fev)DepositorInsertFev (Fev Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tnnt2-Cre-U6-Lmna-sgRNA
Plasmid#206178PurposeExpresses Cre recombinase specifically in cardiomyocytes and uses U6 promoter to express sgRNAs targeting murine Lmna exon 10DepositorInsertCre
UseAAVPromotercTnTAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Loxp-CMV-Loxp-GFP-LA
Plasmid#206199PurposeExpresses GFP-lamin-A only in non-myocyte when delivered into mice carrying a cardiomyocyte-specific Myh6-Cre transgeneDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-mVenus-Q69M(ME)
Plasmid#220597PurposeConstitutive expression of a single-cell discriminating version of mVenus-Q69M (ME) fluorescent protein.DepositorInsertmVenus-Q69M (ME)
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GCaMP6f-WPRE
Plasmid#216275PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of green fluorescent calcium indicator GCaMP6fDepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman Synapsin 1 (hSyn)Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgFAAH
Plasmid#209197PurposeMutagenesis of FaahDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1
Plasmid#209199PurposeMutagenesis of Kcnma1DepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_g5-HT2h
Plasmid#208715PurposeExpresses the green 5-HT sensor GRAB_g5-HT2h in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT2h
UseAAVPromoterhSynAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-BR1-P2A-FusionRed
Plasmid#192819PurposeExpresses BR1 with FusionRed tag in mammalian cellsDepositorInsertBR1 (BRI1 Mustard Weed)
UseAAVTagsFusionRedExpressionMammalianPromoterchicken β-actin promoterAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hPhyB621(Y276H)-P2A-m1V
Plasmid#197377PurposeThe AAV vector for PhyB621(Y276H) and m1VDepositorInsertPhytochrome B Y276H(1-621 aa)
UseAAVTagsP2A-m1VMutationHuman codon optimized PhyB (1-621 aa), Y276H muta…PromoterCMVAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mRhubarb713-P2A-GFP
Plasmid#197172PurposeExpresses the protein of mRhubarb713-P2A-GFP in mammalian cellsDepositorInsertmRhubard713-P2A-GFP
UseAAVAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miRFP2-P2A-GFP
Plasmid#197155PurposeExpresses the protein of miRFP2-P2A-GFP in mammalian cellsDepositorInsertmiRFP2-P2A-GFP
UseAAVAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ef1a-DIO-eGCaMP(plus)
Plasmid#201149PurposeAAV virus production for Cre recombinase dependent expression of eGCaMP(plus)DepositorInserteGCaMP+
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRExpressionMammalianPromotercmb and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1
Plasmid#190902PurposeAAV vector expressing thew GFP reporter gene and human sgHTTDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-alphaCaMKII-dsRed-Express-3XNLS-pA
Plasmid#183802PurposeAAV vector to express nuclear localized dsRed-Express from CaMKIIa promoterDepositorInsertdsRed-Express
UseAAVTagsNLSAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miRFP670-2-P2A-GFP
Plasmid#197170PurposeExpresses the protein of miRFP670-2-P2A-GFP in mammalian cellsDepositorInsertmiRFP670-2-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iRFP670-P2A-GFP
Plasmid#197169PurposeExpresses the protein of iRFP670-P2A-GFP in mammalian cellsDepositorInsertiRFP670-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iRFP713-P2A-GFP
Plasmid#197166PurposeExpresses the protein of iRFP713-P2A-GFP in mammalian cellsDepositorInsertiRFP713-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-E2-Crimson-P2A-GFP
Plasmid#197162PurposeExpresses the protein of E2-Crimson-P2A-GFP in mammalian cellsDepositorInsertE2-Crimson-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-emiRFP703-P2A-GFP
Plasmid#197158PurposeExpresses the protein of emiRFP703-P2A-GFP in mammalian cellsDepositorInsertemiRFP703-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-IFP2-P2A-GFP
Plasmid#197161PurposeExpresses the protein of IFP2-P2A-GFP in mammalian cellsDepositorInsertIFP2-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mRhubarb720-P2A-GFP
Plasmid#197159PurposeExpresses the protein of mRhubarb720-P2A-GFP in mammalian cellsDepositorInsertmRhubarb720-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-BDFP1.6-P2A-GFP
Plasmid#197154PurposeExpresses the protein of BDFP1.6-P2A-GFP in mammalian cellsDepositorInsertBDFP1.6-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mRhubarb719-P2A-GFP
Plasmid#197152PurposeExpresses the protein of mRhubarb719-P2A-GFP in mammalian cellsDepositorInsertmRhubarb719-P2A-GFP
UseAAVAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CBA::EGFP-P2A-myc-C3
Plasmid#129478PurposeAAV2 transfer plasmid for myc-tagged C3 with EGFP under control of the CBA promoterDepositorInsertMyc-tagged (N-terminus) exoenzyme C3 from C. botulinum, P2A, EGFP
UseAAVExpressionMammalianPromoterCBAAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CBA::EGFP-P2A-tC3
Plasmid#129476PurposeAAV2 transfer plasmid for truncated C3 with EGFP under control of the CBA promoterDepositorInserttruncated (AA173-201) exoenzyme C3 from C. botulinum, P2A, EGFP
UseAAVExpressionMammalianPromoterCBAAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4a
Plasmid#194973PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4a) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4d
Plasmid#194975PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4d) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_P1
Plasmid#194972PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4c
Plasmid#194974PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4c) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOttc1494 - pAAV CaMKII SERCaMP-No Tag
Plasmid#192601PurposeAn AAV packaging vector that expresses SERCaMP under control of the CaMKII promoter.DepositorInsertSERCaMP
UseAAVPromoterCaMKIIAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only