Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 41 - 60 of 83 results

  1. PhD Applications After COVID

    Type
    Blog Post
    ...Washington University whose research focuses on Drosophila-parasite pathogen interactions.  ...

  2. CRISPR Plasmids - Drosophila

    Type
    Collection
    ... CRISPR Drosophila CRISPR Plasmids: Drosophila Browse CRISPR...designed for use in Drosophila and other insects. CRISPR...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...CRISPR plasmids have been designed for use in Drosophila and other insects. Cut Fully functional CRISPR...

  5. CRISPR Plasmids - dCas9-FokI

    Type
    Collection
    ...systems and Drosophila. Mammalian ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid ...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...

  6. CRISPR Plasmids - Activate Gene Expression

    Type
    Collection
    ...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...for expression in mammalian systems, bacteria, Drosophila, plants, and yeast. Mammalian Plasmid Gene/Insert...Bacteria Plasmid Gene/Insert Promoter PI Publication Drosophila Plasmid Gene/Insert Promoter PI Publication Plant...

  7. CRISPR Plasmids - Single-Strand Break (Nick)

    Type
    Collection
    ...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...for expression in mammalian systems, bacteria, Drosophila, plants, and yeast. Mammalian Plasmid Gene/Insert...Insert Promoter Selectable Marker PI Publication Drosophila Plasmid Gene/Insert Promoter Selectable Marker...

  8. Sequencing Primers

    Type
    Guide
    ...end of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter... primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer Alpha-factor...Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) Drosophila heat shock promoter, forward primer EF-1a Forward...primer MT Forward CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein promoter, forward primer MMLV-F...promoter, forward primer Ubx-F AACTCGTACTTTGAACAGGC Drosophila Ultrabithorax gene, forward primer V5 Reverse...

  9. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...for expression in mammalian systems, bacteria, Drosophila, plants, C. elegans, yeast, zebrafish, and Xenopus...Bacteria Plasmid Gene/Insert Promoter PI Publication Drosophila Plasmid Gene/Insert Promoter Selectable Marker...

  10. CRISPR Plasmids - Tagging

    Type
    Collection
    ... or C-terminal tagging in Drosophila cells. N terminal tagging in Drosophila cells 3.2 MB C terminal tagging...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR... Natsume, et al. Cell Reports 2016 Förstemann Drosophila Cell Tagging System The Förstemann lab has developed...developed a CRISPR tagging technique for use in Drosophila cells that uses PCR to generate both an expression... tagging in Drosophila cells 3.3 MB Seydoux C. elegans Tagging System Geraldine Seydoux's lab has developed...

  13. CRISPR References and Information

    Type
    Collection
    ...checks for off-target binding. Currently supports: Drosophila, Arabidopsis, zebrafish, C. elegans, mouse, human...tropicalis and X. laevis), zebrafish, sea squirt, Drosophila, C. elegans, Arabidopsis, rice, sorghum, silkworm...checks for off-target binding. Currently supports: Drosophila, Arabidopsis, zebrafish, C. elegans , mouse, ...Group (moderated by Feng Zhang lab): Forum/FAQ Drosophila: General Advice and Forum/FAQ CRISPR Blog Topic...

  14. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...49410 Drosophila BbsI none S. pyogenes Virmilion Bullock and Port pAc-sgRNA-Cas9 49330 Drosophila BspQI...49411 Drosophila BbsI none S. pyogenes Virmilion Bullock and Port pU6-BbsI-chiRNA 45946 Drosophila BbsI...:3tandemgRNAs Drosophila Single plasmid for the expression of two gRNAs from Drosophila U6:1 and U6:3 ...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...system , eg. Mammalian, Lentiviral, AAV, Bacteria, Drosophila, Yeast, Plant, Xenopus, Worm, or Other. Whether...3 promoters. Bullock pCFD5 Drosophila Utilizes endogenous tRNA processing machinery to excise multiple...

  16. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...

  18. CRISPR Plasmids - RNA Editing

    Type
    Collection
    ...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...

  19. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...
Showing: 41 - 60 of 83 results