Skip to main content
Addgene
Showing: 1 - 20 of 20 results
  1. Quick Guide to Working with Drosophila Part 2: Controlling Gene Expression in Flies with Gal4/UAS

    Type
    Blog Post
    ...cell-type specificity! The Gal4/UAS system At a more detailed level, the Gal4/UAS system is a transcription...Applications of the Gal4/UAS system There are a number of fancy ways to use the Gal4/UAS system, and you ...my recent paper to see the Gal4/UAS system in action (5). I use the Gal4/UAS system to knock down gene ...encoded downstream of the UAS sequence are only expressed when Gal4 is expressed. Gal4 expression can be regulated...Controlling multiple genes with Gal4/UAS system One can also use Gal4 to drive expression of multiple ...down. To do this, Drosophila geneticists use the Gal4/UAS system. This incredibly useful, yet simple system...to turn genes on or off. Gal4 is a transcriptional activator that binds to UAS enhancer sequences found...
  2. Plasmids 101: Repressible Promoters

    Type
    Blog Post
    ... bind to GAL4, partially inhibiting the binding of GAL4 to UAS. One can therefore place GAL4 and GAL80...common binary system is the GAL4/UAS system isolated from yeast. In this system, UAS basal promoter expression...expression is low but is activated by GAL4 binding to UAS. If you place the GAL4 gene downstream of a tissue- ...to intermediate expression from QUAS, as seen with GAL4/GAL80 and UAS. QF-mediated repression is reversible...phase of yeast culture. Repressible Binary Systems GAL4/UAS In Drosophila or development studies, you may ... Lee. LexA/lexAop is a complementary system to GAL4/UAS that functions in essentially the same manner,...activators of lexAop. This system is commonly used with GAL4/UAS to examine the expression of reporter genes, or...
  3. Cre-ating New Methods for Site-specific Recombination in Drosophila

    Type
    Blog Post
    ...Drosophila, where expression of Cre from the standard UAS/GAL4 system is toxic to proliferating cells. A Cre-...flies homozygous for a UAS-driven recombinase with flies heterozygous for tubulin-GAL4. For Dre, Flp, KD, ...50% of offspring carried both the recombinase and GAL4, indicating that the recombinases were inherited...In contrast, 0/79 offspring carried both Cre and GAL4, further emphasizing the toxicity of this enzyme...
  4. Quick Guide to Working with Drosophila Part 3: Genome Engineering in Flies

    Type
    Blog Post
    ...experimental model organism. I then described the Gal4/UAS system used by geneticists to study gene function...favorite gene (YFG).  Sometimes, you want to use the Gal4/UAS system, but the available reagents do not match...by filtering by fly as species of gene. Find Gal4 and UAS plasmids at Addgene Choosing a vector to generate...
  5. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...transactivator is used. UAS General expression mRNA Drosophila promoter conaining Gal4 binding sites Specific...Specific Requires the presence of Gal4 gene to activate promoter. Ac5 General expression mRNA Strong insect... be used independently or together. Regulated by GAL4 and GAL 80. TEF1 General expression mRNA Yeast...
  6. Five Popular Model Organisms

    Type
    Blog Post
    ...fly is the array of genetic tools, such as the GAL4/UAS and LexA system, that allows scientists to easily...but can be quite difficult and time consuming. GAL4/UAS was first described in 1993 by Norbert Perrimon...
  7. Qi Lab CRISPR Page

    Type
    Collection
    ... pU6-sgGAL4-1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter... pU6-sgGAL4-4 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter...
  8. Tips for Screening with Yeast Two Hybrid Systems

    Type
    Blog Post
    ...able to bind to the upstream activation sequence (UAS) of its target gene, in this case a reporter gene...Although the original Y2H systems utilized the yeast Gal4 activator, bacterial LexA DBD and the lacZ reporter...the binding sites for the protein partner or the UAS/reporter gene, the same bait and prey libraries can...
  9. Open Resources and Plasmid Tools For Studying C. elegans

    Type
    Blog Post
    ... Wang, Han, et al. "cGAL, a temperature-robust GAL4UAS system for Caenorhabditis elegans." Nature methods...2018, the lab expanded on this tool by splitting cGAL4 in two and binding each half to a gp41-1-N-intein...
  10. Worm Expression Resources

    Type
    Collection
    ...Sternberg Lab. Plasmids for the temperature-robust GAL4-UAS system in C. elegans . Synthetic Biology Synthetic...
  11. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...or localization experiments Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination ...pACT2.2 - Yeast 2-hybrid plasmids Fly UAS, MT Targeted Gene Expression - Rubin... attB site for high expression of UAS-driven transgenes Worm unc-54, variety of worm gene...under the metallothionein promoter pACU2 - Modified pUAST vector containing both P-elements...
  12. Promoters

    Type
    Guide
    ...promoter for small RNA expression UAS Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters...
  13. Validated gRNA Sequences

    Type
    Collection
    ... Mendenhall GAL4 UAS GAACGACTAGTTAGGCGTGTA 46916 activate S. pyogenes 23849981 Qi GAL4 UAS GTTGGAGCACTGTCCTCCGAACGT...23849981 Qi GAL4UAS TGGGGACAGTACTCCGCTCGAGT 64158 activate S. pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC...TGGGTCTTCGGAGGACAGTACTC 64157 activate S. pyogenes 25619936 Sato GAL4UAS TGGTCCGTCTAGAAACTCGGTAC 64159 activate S. pyogenes...
  14. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... mCherry 5X UAS Huntington's Pedro Domingos 201249 pUAST alpha-SynWT-EGFP SNCA GFP 5X UAS Parkinson's ... pM-ErbB4CTF ERBB4 GAL4-BD ALS Marius Sudol 17798 pM-ErbB4CTF-PY1 mutant ERBB4 GAL4-BD ALS Marius Sudol...pM-ErbB4CTF-PY3 mutant ERBB4 GAL4-BD ALS Marius Sudol 17800 pM-ErbB4-delta-kinase ERBB4 GAL4-BD ALS Marius Sudol... mutant ERBB4 GAL4-BD ALS Marius Sudol 17802 pM-ErbB4-delta-kinase-PY3 mutant ERBB4 GAL4-BD ALS Marius... 214613 pcDNA3_ERBB4-NTEV-tcs-GV-2xHA ERBB4 TEV, Gal4, VP16, HA CMV ALS Michael Wehr 214672 lucMAPT-30D...
Showing: 1 - 20 of 20 results