...ApoB-NanoLuc reporter by inserting the NanoLuc luciferase downstream of the apoB gene. Using this reporter...

...evolved from chloramphenicol acetyltransferase to luciferase, the basic assay remains widely used today.  ...

...Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly luciferase. The bait and prey...immunoprecipitated from the cells using the Protein A tag. The luciferase activities can then be measured and normalized... assess interactions. Higher relative firefly luciferase activity in the Co-IP compared of a control Co-IP...

...receptor, which can then activate expression of a luciferase reporter in the nucleus. The Roth lab showed ...

...pTac GFP, Luciferase (LuxCDABE) Attila Karsi Broad host range vectors for expressing luciferase and fluorescent...Quorum sensing molecule) Cynthia Collins Contains luciferase inducible by the quorum sensing molecule, 3OC6HSL...promoter can be found in pCS-PesaRlux controlling luciferase expression. pCW-LIC 26098 3x Tac promoter (hybrid...

...expression, lentiviral, retroviral, AAV, RNAi, luciferase, cre/lox, yeast expression, worm expression, ...

...donor plasmids for protein tagging, including luciferase (NanoLuc), fluorescent proteins (TagGFP2, TagBFP...

... Resources You May Also Like... Luminescence: Luciferase Plasmids Blog: Which FP Should I Use? Blog: How...

....org Fluorescent Biosensors Collection Split Luciferase systems, including NanoLuc®, DULIP, LuTHy Other...

...RNA editing tools.   Fig. 1 Schematic of luciferase RNA knockdown assays using Cas7-11   Use ...

...Cara E., and James B. Kaper. "Use of stabilized luciferase-expressing plasmids to examine in vivo-induced...

...Protein Resources Find Other Plasmids that Glow (Luciferase Plasmids) Find Optogenetics Resources ...

...constitutively expresses a reporter protein (e.g., GFP or luciferase) that is either co-transfected with the test ...

...Retroviral pEF1a-IRES-Neo IRES Mammalian MSCV-IRES-Luciferase IRES Retroviral pWPI IRES Lentiviral AmCyan-P2A-mCherry...

...Mammalian Vectors Read about Reporter Gene like Luciferase and GFP Resources on Addgene.org Find Plasmids...

...AGTCAAGTAACAACCGCGA 3' end of luciferase, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer... primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...

...Zinc Fingers Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus...

...single copy in mammalian cells; Expresses firefly luciferase hairpin and GFP under pTREtight promoter None...pSBtet-GP Sleeping Beauty transposon system; has luciferase in cloning site; see article for additional selection...

...binding sites increased activation of HIV promoter-luciferase constructs. In multiple HIV-1 latent T cell lines...

...backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Cre, luciferase, and sgRNA expression EFS AAV Zhang 60229 AAV...Retroviral Luikart 67503 pF CAG luc-EGFP-cre puro Luciferase - EGFP- Cre fusion CAG Mammalian Stringer 68448...12463 p231 pCMVe-betaAc-STOP-luc Cre dependent luciferase expression Mammalian Green 32145 pJFRC172-10XUAS-loxP...