...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...maturation reporter (pmRFP-LC3) Dissection of the autophagosome maturation process by a novel reporter protein...Multicoloured voltage reporters (QuasAr2) Bright and fast multicoloured voltage reporters via electrochromic...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...genetically encoded calcium sensor (GECI) that reports with lifetime and intensity changes A turquoise...

...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...

...is typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells,... separate transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich...inactive dCas9 fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable...The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-... complex through interactions between the gRNA scaffold and surface-exposed positively-charged grooves...or co-expression of dCas9-VP64 with a modified scaffold gRNA and additional RNA-binding helper activators...activators have been developed for bacteria by using a scaffold RNA that contains the gRNA and an RNA hairpin ...