...Plasmid Collection CRISPR Casilio CRISPR/Cas Platform from JAX - Albert Cheng CRISPR-on: an RNA-guided ...Browse depositor collections of antibody, CRISPR, disease research, visualization, protein expression...

...plasmids, kits, and pooled libraries. Find tools for CRISPR, fluorescent proteins, optogenetics, biosensors... Genome Engineering Genome Engineering Overview CRISPR Cre-lox TALENs Zinc Fingers Luminescence Fluorescent...pooled libraries. Pooled Library Types cDNA shRNA CRISPR gRNAs Depositor Collections A modular set of plasmids...view all collections. Depositor Collection Types CRISPR Fluorescent Proteins Protein Expression Synthetic...

...Plasmid Gene/Insert Industry PI Pooled Libraries CRISPR Pooled Libraries are useful tools for genetic screening...Human SLC Activation Library 132561 Superti-Furga CRISPR activation library targeting human SLC proteins...Human SLC Knockout Library 132552 Superti-Furga CRISPR knockout library targeting human SLC proteins. ...Mouse SLC Knockout Library 141436 Superti-Furga CRISPR knockout library targeting mouse SLC proteins. ...

...Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts CRISPR requires... CRISPR Empty gRNA Vectors CRISPR Plasmids: Empty gRNA Expression Vectors Browse CRISPR Plasmids...plasmids and therefore are not limited to a single CRISPR function. Alternatively, gRNA-only plasmids can...gRNA sequence, such as BsbI or BsaI Cas9 (or other CRISPR) system that the vector was designed to be used...to be used with. crRNAs used with Cpf1 or other CRISPR systems are also listed here and denoted as such...enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity...Plasmids Expression System Description PI Multiplex CRISPR/Cas9 Assembly System Kit Mammalian A system for...

...Addgene's CRISPR Guide for a general introduction to CRISPR technology or the mammalian CRISPR resources...'s Plasmids for Stem Cell Research page. CRISPR Tools CRISPR technology is a promising therapeutic approach...examples of additional CRISPR resources can be found below: Base Editing RNA Editing CRISPR-based DNA methylation...Resource Center MECP2 Animal Models Human Cell Lines CRISPR Tools Plasmids Resources The (Link opens in a new...

...using CRISPR diagnostics: SARS-CoV-2 DETECTR Find Doudna Lab Cas12a plasmids Addgene's full CRISPR guide...coronavirus - Enabling coronavirus detection using CRISPR-Cas13: Open-access SHERLOCK research protocols ...develop the method termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has...guide and summary of CRISPR pooled libraries . FlipGFP-based activity reporter of SARS-CoV-2 main protease...now available from Ray Owens' lab. Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and...Abbott, et al. Cell. 2020 May 14;181(4):865-876.e12. CRISPR tools and reporters now available from Stanley ...

...Initiative (iNDI) Collection You May Also Like... CRISPR Guide CRISPR Protein Tagging Plasmids for Stem Cell Research...

...list of our bacterial CRISPR plasmids, see here . pwtCas9-bacteria 44250 CRISPR Stanley Qi Anhydrotetracycline... list of our bacterial CRISPR plasmids, see here . pgRNA-bacteria 44251 CRISPR Stanley Qi Expression of...alter bacterial genomes. From recombineering to CRISPR , this collection contains a variety of tools to...research. Plasmid ID Technique PI Purpose pCas9 42876 CRISPR Luciano Marraffini Bacterial expression of Cas9... For a more comprehensive list of our bacterial CRISPR plasmids, see here . pGRG Series Various Plasmids...

... Plasmid Collection You May Also Like... CRISPR Guide CRISPR Protein Tagging Fluorescent Protein Guide...Roberts B, et al. 2017. Systematic gene tagging using CRISPR/Cas9 in human stem cells to illuminate cell organization...

...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...

...al. Commun Biol. 2022 Aug 13. See More CRISPR Tools Find CRISPR pooled libraries available from Addgene...neurodegeneration research. Disease Info Plasmid Collection CRISPR Tools iPSC Differentiation Factors Antibodies Fluorescent...about the blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons...

...BMC Biotechnol. 2006 Dec 7;6:46. John McCafferty CRISPR system to rapidly engineer the constant immunoglobulin...diversification of hybridoma-produced antibodies by CRISPR/HDR genomic engineering. Sci Adv. 2019 Aug 28;5...

...Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron Conversion by CRISPR-CasRx Alleviates Symptoms ...mitosis. Nat Commun. 2016 Mar 7;7:10869. Hu CRISPRa Human CRISPR activator system for reprogramming human...enogenous genes Human pluripotent reprogramming with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski... Brennand iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN Human Transcription Factor-Mediated Differentiation...

...Kinase ORF collection Fluorescent Protein Tools CRISPR Plasmids This resource is a collaboration between...

...generated a number of Shared Research Tools , such as CRISPR genome editing tools deposited with Addgene. Browse...

...Engineering Technologies TALEN Engineering Reagents CRISPR Plasmids...

...Keith Joung Lab plasmids Daniel Voytas Lab plasmids CRISPR plasmids This page lists plasmid vectors into which...

...Vectors You may also like... Keith Joung Lab plasmids CRISPR plasmids Zinc Finger Consortium This page lists...

...lentiviral plasmids to express your CRISPR gRNA? Please see our CRISPR Empty gRNA plasmids table and search...

...Keith Joung Lab plasmids Dan Voytas Lab plasmids CRISPR plasmids The Joung Lab has developed three platforms...