...terminator, reverse primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter, forward primer...primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD Biosciences) 3' end of DsRed1, forward primer DsRed1-N GTACTGGAACTGGGGGGACAG...GTACTGGAACTGGGGGGACAG (BD Biosciences) 5' end of DsRed1, reverse primer EBV Reverse GTGGTTTGTCCAAACTCATC...

...supE44 ara14 galK2 lacY1 proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha Invitrogen F- Phi80lacZDeltaM15...genetic elements using specifically engineered plasmids, commonly referred to as vectors, which have become...division is reduced (i.e., it takes more time to copy this extra DNA). Because of this reduced fitness, ...In 1975, Frederick Sanger developed the process termed Sanger sequencing, sometimes referred to as chain-termination...would be necessary to isolate a sequence of a few hundred or few thousand basepairs from the entire human...the original cell. The plasmid DNA is similarly referred to as cloned DNA, and this process of generating...organisms, including plants, worms, mice, and even cultured human cells. Although plasmids were originally...