Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pCMV6-XL5
Information
- Source/Vendor
- Origene
- Plasmid Type
- Mammalian Expression
- Promoter
- CMV
- Expression Level
- High
- Cloning Method
- Restriction Enzyme
- Size
- 4707
- 5' Sequencing 1 Primer
- pCMV6 forward
- 5' Sequencing 1 Primer Sequence
- GGACTTTCCAAAATGTCG
- 3' Sequencing 1 Primer
- T7
- 5' Sequencing 2 Primer
- pCMV6 reverse
- 5' Sequencing 2 Primer Sequence
- TAATCCTGTTCCGACCACCC
- 5' Terminal
- N-Term
- 5' Terminal 2
- C-Term
- 3' Terminal
- N-Term
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral
Sequence
Published Plasmid Map
![](https://media.addgene.org/data/94/07/5eb143f4-a35e-11e1-9976-003048dd6500.jpeg)