Skip to main content

pBad-HPII TAG283
(Plasmid #105843)

  • Purpose
    expresses E. coli HPII catalase with TAG stop codon at site 283 and N-terminal 6x his tag
  • Depositing Lab
  • Depositing Organization
    Oregon State University
    Located in the United States of America
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105843 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBad
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4100
  • Total vector size (bp) 6476
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    hydroperoxidase II catalase
  • Alt name
    HPII
  • Species
    E. coli
  • Insert Size (bp)
    2376
  • Mutation
    TAG stop codon at site 283
  • Promoter pBad/arabinose
  • Tag / Fusion Protein
    • 6x his tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://openlibrary-repo.ecampusontario.ca/jspui/handle/123456789/838 for Chemical Biology & Biochemistry Laboratory Using Genetic Code Expansion Manual.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBad-HPII TAG283 was a gift from Ryan Mehl (Addgene plasmid # 105843 ; http://n2t.net/addgene:105843 ; RRID:Addgene_105843)
  • For your References section:

    Chemical Biology & Biochemistry Laboratory : Using Genetic Code Expansion Manual. Mehl R, van Zee K, Kean K. 2020