pRPF144
(Plasmid
#106372)
-
PurposeC. difficile constitutive expression system. Shuttle plasmid containing constitutive Pcwp2 -gusA
-
Depositing Labs
-
Depositing OrganizationImperial College London
Located in the United Kingdom of Great Britain and Northern Ireland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106372 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 106372-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 106372-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMTL960
- Backbone size w/o insert (bp) 6218
- Total vector size (bp) 8258
-
Vector typeE. coli - C. difficile shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 15 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLow copy in C. difficile following conjugation and selected with thiamphenicol
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePcwp2-gusA
-
Insert Size (bp)2040
-
Mutationcodon optimised for C. difficile
-
Entrez GenegusA (a.k.a. ECO111_2086)
- Promoter Pcwp2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CACCTCCTTTTTGACTTTAAGCCTACGAATACC
- 3′ sequencing primer CACCGACGAGCAAGGCAAGACCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 106372-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 106372-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRPF144 was a gift from Robert Fagan & Neil Fairweather (Addgene plasmid # 106372 ; http://n2t.net/addgene:106372 ; RRID:Addgene_106372) -
For your References section:
Clostridium difficile has two parallel and essential Sec secretion systems. Fagan RP, Fairweather NF. J Biol Chem. 2011 Aug 5;286(31):27483-93. doi: 10.1074/jbc.M111.263889. Epub 2011 Jun 9. 10.1074/jbc.M111.263889 PubMed 21659510