pEGFP mCherry-ApoB-EGFP
(Plasmid
#112859)
-
PurposePlasmid bearing the editing target of APOBEC1 fused between the mCherry cds and the EGFP one. In presence of APOBEC1, the CAA codon in ApoB is edited to a Stop codon (UAA), leading to loss of EGFP
-
Depositing Lab
-
Depositing OrganizationInstitute for Cancer Research, Prevention and Clinical network (ISPRO)
Located in Italy -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112859 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 112859-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 112859-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4733
- Total vector size (bp) 5866
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-apoB-EGFP
-
SpeciesSynthetic
-
Insert Size (bp)1926
- Promoter CMV promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- 3′ sequencing primer TTCAGGTTCAGGGGGAGGTG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 112859-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 112859-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP mCherry-ApoB-EGFP was a gift from Silvestro Conticello (Addgene plasmid # 112859 ; http://n2t.net/addgene:112859 ; RRID:Addgene_112859) -
For your References section:
Flow-cytometric visualization of C>U mRNA editing reveals the dynamics of the process in live cells. Severi F, Conticello SG. RNA Biol. 2015;12(4):389-97. doi: 10.1080/15476286.2015.1026033. 10.1080/15476286.2015.1026033 PubMed 25806564
Map uploaded by the depositor.
