Skip to main content
Addgene
Open Menu

pCMV-MA-VN
(Plasmid #123283)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 123283 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 123283-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 123283-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCMV
  • Backbone manufacturer
    NIH AIDS Reagent Program (Cat. No. 11468)
  • Backbone size w/o insert (bp) 3970
  • Total vector size (bp) 4866
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Matrix
  • Alt name
    Gag p17
  • Alt name
    p17
  • Alt name
    MA
  • Species
    Human immunodeficiency virus 1
  • Insert Size (bp)
    896
  • GenBank ID
    NP_579876.2
  • Promoter CMV
  • Tag / Fusion Protein
    • VN: N-terminus of split Venus (a.a. V1–A154) I152L variant (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CMV forward: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer SV40-pArev: CCTCTACAAATGTGGTATGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-MA-VN was a gift from Erik Procko (Addgene plasmid # 123283 ; http://n2t.net/addgene:123283 ; RRID:Addgene_123283)

  • For your References section:

    Conformational engineering of HIV-1 Env based on mutational tolerance in the CD4 and PG16 bound states. Heredia JD, Park J, Choi H, Gill KS, Procko E. J Virol. 2019 Mar 20. pii: JVI.00219-19. doi: 10.1128/JVI.00219-19. 10.1128/JVI.00219-19 PubMed 30894475
Related items:
Commonly requested with: