Skip to main content

pCMV-N-HA-Gp78
(Plasmid #123591)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 123591 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 123591-D50 50 μg of DNA in Tris buffer $495
DNA 123591-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 3766
  • Total vector size (bp) 5686
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    autocrine motility factor receptor
  • Alt name
    gp78
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1920
  • GenBank ID
    NM_011787.2
  • Entrez Gene
    Amfr (a.k.a. gp78)
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GATGTTGCCTTTACTTCTAGG
  • 3′ sequencing primer TCACTGCATTCTAGTTGTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-N-HA-Gp78 was a gift from Bruce Beutler (Addgene plasmid # 123591 ; http://n2t.net/addgene:123591 ; RRID:Addgene_123591)
  • For your References section:

    LMBR1L regulates lymphopoiesis through Wnt/beta-catenin signaling. Choi JH, Zhong X, McAlpine W, Liao TC, Zhang D, Fang B, Russell J, Ludwig S, Nair-Gill E, Zhang Z, Wang KW, Misawa T, Zhan X, Choi M, Wang T, Li X, Tang M, Sun Q, Yu L, Murray AR, Moresco EMY, Beutler B. Science. 2019 May 10;364(6440). pii: 364/6440/eaau0812. doi: 10.1126/science.aau0812. 10.1126/science.aau0812 PubMed 31073040