pMSCV-puro-mycRSK2wt
(Plasmid #15827)

• Depositing Lab: Jing Chen
• Publication: Kang et al Cancer Cell. 2007 Sep . 12(3):201-14.

Backbone

• Vector backbone: pMSCV-puro-gateway
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6391
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: LB broth
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ribosomal S6 kinase 2
• Alt name: RSK2
• Species: M. musculus (mouse)
• Insert Size (bp): 2253
• Mutation: wild type
• GenBank ID: AY083469
• Entrez Gene: Rps6ka3 (a.k.a. MAPKAPK-1b, MPK-9, Rs, Rsk2, S6K-alpha3, p90RSK3, pp90RSK2)
• Tag / Fusion Protein:
  • myc (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ cloning site: Gateway1 (not destroyed)
• 3′ cloning site: Gateway2 (not destroyed)
• 5′ sequencing primer: CCCTGGAACCTCCTCGTTCGACC
• 3′ sequencing primer: GAGACGTGCTACTTCCATTTGTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Template pKH3-RSK2 was obtained from Morten Frodin in Department of Clinical Biochemistry, Glostrup Hospital, Denmark.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry