Skip to main content

2X_pX458_pSpCas9(BB)-2A-GFP_SOX17_cKO
(Plasmid #195494)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195494 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    2X_pX458_pSpCas9(BB)-2A-GFP (Plasmid #172221)
  • Backbone manufacturer
    Alexander Meissner
  • Backbone size w/o insert (bp) 9699
  • Total vector size (bp) 9703
  • Modifications to backbone
    sgRNAs targeting the entire gene-body of human SOX17
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA
  • gRNA/shRNA sequence
    AGCTCCGGCTAGTTTTCCCG, ACGTGCCACAGCGATTAGTA
  • Species
    H. sapiens (human)
  • GenBank ID
    hg19, chr8:55370294-55373673
  • Entrez Gene
    SOX17 (a.k.a. VUR3)
  • Promoter U6
  • Tags / Fusion Proteins
    • 3XFLAG (N terminal on insert)
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGATACAAGGCTGTTAGAGAG
  • 3′ sequencing primer ggaaagtccctattggcgtta
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    sgRNAs were ordered from Sigma-Aldrich as synthetic ssODN oligonucleotides

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    2X_pX458_pSpCas9(BB)-2A-GFP_SOX17_cKO was a gift from Alexander Meissner (Addgene plasmid # 195494)
  • For your References section:

    T-REX17 is a transiently expressed non-coding RNA essential for human endoderm formation. Landshammer A, Bolondi A, Kretzmer H, Much C, Buschow R, Rose A, Wu HJ, Mackowiak SD, Braendl B, Giesselmann P, Tornisiello R, Parsi KM, Huey J, Mielke T, Meierhofer D, Maehr R, Hnisz D, Michor F, Rinn JL, Meissner A. Elife. 2023 Jan 31;12:e83077. doi: 10.7554/eLife.83077. 10.7554/eLife.83077 PubMed 36719724