pTE5400_pMBP_CDS dropout vector
(Plasmid
#221189)
-
Purpose(Empty Backbone) Expression vector for N-terminally His-tagged maltose binding protein (10xHis-MBP) fused to a protein of interest
-
Depositing Lab
-
Depositing OrganizationMax Planck Institute for Terrestrial Microbiology
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221189 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSB1C3
- Backbone size (bp) 4940
-
Modifications to backboneremoved BsmBI site in cat gene, added pET16b expression cassette (lacI + T7 promoter-lacO) + E. coli maltose binding protein, added sfGFP dropout sequence for the CDS according to the Marburg collection
-
Vector typeBacterial Expression
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- 10x His-tag + E. coli maltose binding protein (MBP) (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GGTCGTCAGACTGTCGATG
- 3′ sequencing primer GAAGCCTGCATAACGCGAAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For details on placeholder/dropout sequences see Stukenberg et al.: https://doi.org/10.1021/acssynbio.1c00126.
Please visit https://doi.org/10.1101/2024.04.26.591264 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE5400_pMBP_CDS dropout vector was a gift from Tobias Erb (Addgene plasmid # 221189 ; http://n2t.net/addgene:221189 ; RRID:Addgene_221189) -
For your References section:
In vitro transcription-based biosensing of glycolate for prototyping of a complex enzyme cascade. Barthel S, Brenker L, Diehl C, Bohra N, Giaveri S, Paczia N, Erb TJ. Synth Biol (Oxf). 2024 Sep 20;9(1):ysae013. doi: 10.1093/synbio/ysae013. eCollection 2024. 10.1093/synbio/ysae013 PubMed 39399720